1. Introduction
In Iran, gastrointestinal cancers are among the top five most prevalent cancers, with recent epidemiological studies reporting a rising trend in colorectal cancer (CRC)incidence [ 1 , 2 ]. Understanding the molecular basis of CRC is crucial for identifying factors involved in tumor initiation, progression, and response to therapy. Various genetic, environmental, and individual factors contribute to CRC development. Among molecular regulators, long non-coding RNAs (lncRNAs) have emerged as critical players in gene expression regulation, tumorigenesis, and clinical outcomes, including diagnosis, prognosis, and treatment response [ 3 , 4 ].
Plasmacytoma variant translocation 1 (PVT-1) is a 1957 bp lncRNA located at chromosomal locus 8q24.21, comprising nine exons. PVT-1 is recognized as an oncogene involved in multiple cancer types, including CRC. Functional studies indicate that silencing PVT-1 suppresses epithelial-mesenchymal transition (EMT) and affects proliferation, apoptosis, migration, and the cell cycle via regulation of key tumorigenic factors such as cyclin D1, p21, and MYC [ 5 , 6 ]. Elevated PVT-1 expression has been associated with enhanced proliferation, invasion, metastasis, and poor prognosis in CRC, highlighting its potential as a diagnostic and prognostic biomarker, potentially outperforming traditional markers like carcinoembryonic antigen [ 7 ].
TGF-β - the versatile cytokine transforming growth factor-beta - governs cell growth, differentiation, and apoptosis by mediating signals through the TGF-β/Smad pathway. Dysregulation of this pathway, including mutations in Smad proteins, contributes leading to abnormal cell proliferation and tumor advancement in CRC. Specifically, Smad4 deletion correlates with poor response to chemotherapy, while Smad7 deletion is associated with favorable prognosis [ 8 , 9 ].
Emerging evidence suggests that lncRNAs, including PVT-1, may influence TGF-β signaling either directly or via intermediate pathways, thereby promoting tumor progression and metastasis. Based on this rationale, we hypothesize that PVT-1 may regulate TGF-β expression in CRC, forming a PVT-1/TGF-β regulatory axis that contributes to tumor development and progression. This hypothesis is supported by recent studies (2022–2024) demonstrating functional interactions between oncogenic lncRNAs and TGF-β signaling in colorectal and other cancers [ 10 - 12 ].
Accordingly, this study was designed to explore the association between PVT-1 lncRNA and TGF-β gene expression in Iranian colorectal cancer patients, to explore their potential roles as molecular biomarkers and therapeutic targets.
2. Materials and Methods
2.1. Participants
The study included 50 patients with colorectal cancer (case group) and 50 patients with non-cancerous colorectal polyps (control group). A cross-sectional, case–control design was employed, comprising 100 participants who referred to Imam Hossein Hospital in Tehran, Iran between 2020 and 2022. CRC diagnosis was confirmed by pathology following colonoscopy. Exclusion criteria included any history of cancer treated with chemotherapy or radiotherapy.
Approval for the study’s ethical considerations was obtained from the [Shahid Beheshti University of Medical Sciences and North Tehran Branch of Islamic Azad University] and before participating in the study, all individuals signed a written informed consent form.
We acknowledge that using patients with benign polyps as controls does not represent truly healthy tissue, as polyps may harbor molecular alterations. This limitation is discussed, and future studies may consider using adjacent normal tissues. Demographic characteristics, including age and sex, were recorded. A greater mean age was observed in the case group (62.56±16.41) compared to the control group (58.41±11.13 years), and sex distribution differed slightly (56% female in cases vs 40% female in controls).
2.2. Gene expression study
Tissue blocks fixed in formalin and embedded in paraffin (FFPE) were utilized to prepare colorectal tumor and control tissue samples. Extraction of RNA was conducted using the RNX Plus kit, as recommended by the manufacturer. RNA integrity and purity were verified using spectrophotometry and agarose gel electrophoresis, complementary DNA (cDNA) was generated employing the miRNA 1st-Strand cDNA Synthesis Kit (Parsgenome).
Forward and reverse primers for PVT-1, TGF-β, and reference genes (U6 and GAPDH) are listed in Table 1. Primer efficiency was validated using standard curves prior to quantitative polymerase chain reaction (qPCR) experiments. Each sample was run in triplicate for technical reproducibility. SYBR Green I Master Mix was employed to perform real-time PCR in a 48-well plate with a reaction of 20 μL reaction was assembled, consisting of 10 μL Master Mix and 1 μL per primer, and 1.5 μL of cDNA (5 ng). Cycling conditions were: 95 °C for 15 s, 60 °C for 30 s, and 90 °C for 15 s for 40 cycles. Relative expression levels were calculated via the comparative Ct (ΔΔCt) method and adjusted relative to U6 for PVT-1 and GAPDH for TGF-β.
| Gene | Forward Primer (5’→3’) | Reverse Primer (5’→3’) |
|---|---|---|
| PVT-1 lncRNA | ATAGATCCTGCCCTGTTTGC | CATTTCCTGCTGCCGTTTTC |
| U6 | CTCGCTTCGGCAGCACAT | TTTGCGTGTCATCCTTGCG |
| TGF-β | TACCTGAACCCGTGTTGCTCTC | GTTGCTGAGGTATCGCCAGGAA |
| GAPDH | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA |
2.3. Statistical analysis
All statistical analyses were carried out in SPSS (Version 26, SPSS Inc., USA). Normal distribution was tested using the Shapiro-Wilk method, and intergroup differences were evaluated using one-way analysis of variance (ANOVA) and Tukey’s post-hoc comparisons, or non-parametric tests as appropriate. Correlation analyses were performed to obtain R² values, and results with P<0.05 were regarded as significant. Multiple comparisons were accounted for in the analyses. Sample size was determined based on previous studies and power calculations to detect significant differences in gene expression.
3. Results
3.1. Patient demographics
The study included 50 patients with colorectal cancer (case group) and 50 patients with non-cancerous colorectal polyps (control group). In the case group, 22 (44%) were male and 28(56%) were female, whereas the control group included 30 males (60%) and 20 females (40%). The mean age was 62.56±16.42 years in the case group and 58.41±11.13 years in the control group. The age range of participants was 41–86 years.
Other demographic characteristics included family history of cancer (24% in cases vs 10% in controls) and smoking status (36% in cases vs 26% in controls). These factors are described in the revised manuscript to provide a clear overview of patient characteristics. The distribution of tumor locations in the colorectal region is shown in Figure 1.
Figure 1. Frequency distribution of tumor locationNote: The relatively small sample size (n=50 per group) is acknowledged in the manuscript as a limitation for interpreting subgroup analyses and biomarker ROC analyses
3.2. Expression of PVT-1 lncRNA and TGF-β
The expression of PVT-1 lncRNA in tumor tissue was significantly higher compared to control samples (P<0.05) (Figure 2A). Similarly, TGF-β gene expression was significantly increased in tumor tissues compared to controls (P<0.05) (Figure 2B). These findings indicate upregulation of both PVT-1 and TGF-β in colorectal cancer tissue relative to non-cancerous polyp samples.
Figure 2. Expression changes of PVT-1 lncRNA gene (A) and TGF-β (B) (**P<0.01)
3.3. Frequency distribution of tumor differentiation rate
Pathological examination revealed that tumors were well differentiated in 14 patients (28%), moderately differentiated in 19 patients (38%), and poorly differentiated in 17 patients (34%). PVT-1 lncRNA expression was significantly higher in well differentiated tumors compared to moderately and poorly differentiated groups (P=0.01) (Figure 3A). No significant association was observed between TGF-β expression and tumor differentiation (P=0.6) (Figure 3B).
Figure 3.PVT-1 (A) and TGF-β (B) gene expression changes in the patient group based on clinical course
3.4. Biomarker potential
The potential of PVT-1 lncRNA and TGF-β as biomarkers was evaluated using ROC curve analysis. For PVT-1 lncRNA, the area under the curve (AUC) was 0.8664±0.0324 (95% CI, 0.802%, 0.922%), with a sensitivity of 86.67% and specificity of 73.33% (Figure 4A). For TGF-β, the AUC was 0.6187±0.617 (95% CI, 0.495%, 0.732%), with a sensitivity of 73.81% and specificity of 62.38% (Figure 4B). The “Rock curve” terminology was corrected to “ROC curve.”
Figure 4. Rock curve to evaluate the biomarker potential of PVT-1 lncRNA (A) and TGF-β (B) in CRC
These results suggest that PVT-1 lncRNA exhibits stronger diagnostic potential compared to TGF-β for colorectal cancer detection.
4. Discussion
The demand for new molecular markers and the diversity of lncRNAs have led to increased research in this field. The expression of lncRNA PVT-1 and TGF-β in colorectal cancer tissue was compared with tissue from patients with non-cancerous polyps. Increased expression of both genes was observed in cancer tissue, consistent with their reported oncogenic potential.
Overexpression of lncRNAs, including CCAT1, MALAT1, PVT-1, and HOTAIR, has been associated with tumor formation and metastasis in colon cancer cells [ 10 , 11 ]. However, the expression of lncRNAs is not always increased; downregulation of Evf-2 and GAS5 can inhibit cell cycle progression and induce apoptosis [ 12 , 13 ]. In our study, PVT-1 expression was significantly higher in CRC tissues. TGF-β expression was also elevated, suggesting a possible association with PVT-1, but mechanistic links cannot be confirmed based on this study.
Our results indicate higher PVT-1 expression in welldifferentiated tumors, which may seem contradictory to its proposed role in tumor progression. This finding highlights the complexity of PVT-1 function and suggests that its role may vary depending on tumor differentiation.
Several studies have reported the oncogenic role of PVT-1 and its association with TGF-β signaling pathways in cancer. PVT-1 knockdown reduces proliferation and invasion in CRC cell lines and affects TGF-β signaling [ 14 ]. PVT-1 regulates EMT markers and TGF-β/ Smad signaling in pancreatic cancer [ 15 ]. While these studies support a potential interaction, our cross-sectional study cannot establish causality. Co-expression does not imply a direct mechanistic link.
Cross-sectional design and relatively small sample size and are limitations of our study. Additionally, the use of patients with non-cancerous polyps as controls and demographic imbalances, including differences in age, sex, family history of cancer, and smoking status, may influence the results. These limitations should be considered when interpreting the findings.
In conclusion, our study demonstrates increased expression of PVT-1 lncRNA and TGF-β in CRC tissues compared to non-cancerous polyp tissues. These molecules may serve as potential biomarkers for prognosis, but further longitudinal and mechanistic studies are needed to clarify their functional relationship and clinical utility [ 16 - 23 ].
5. Conclusion
In conclusion, the present study demonstrated a significant upregulation of PVT-1 lncRNA and TGF-β in colorectal cancer tissues compared with non-cancerous polyp samples, highlighting their potential involvement in colorectal carcinogenesis. The observed expression differences, along with acceptable diagnostic performance in ROC analysis, suggest that these biomarkers may serve as valuable molecular indicators for the detection of colorectal cancer. Despite minor demographic differences between study groups, the consistency of results supports the reliability of the findings. Nevertheless, further large-scale and mechanistic studies are required to validate the clinical applicability of PVT-1 lncRNA and TGF-β and to clarify their roles in tumor progression and personalized diagnostic strategies.
Acknowledgements
The authors gratefully acknowledge everyone who supported this research.
Compliance with ethical guidelines
This study was conducted in accordance with the ethical standards of the institutional and national research committees. This study was approved by the Research Ethic Committee of Shahid Beheshti University of Medical Sciences, Tehran, Iran (Code: IR.SBMU.RETECH. REC.1399.886).
Data availability
The data that support the findings of this study are available on request from the corresponding author.
Funding
This research did not receive any grant from funding agencies in the public, commercial, or non-profit sectors.
Authors' contributions
Conceptualization and study design: Fatemeh Aminzare, Sahar Mansoubi, and Mohaddeseh Mohsenpour; Data acquisition: Sahar Mansoubi and Fatemeh Aminzare; Data analysis and interpretation: Sahar Mansoubi and Mohaddeseh Mohsenpour; Writing the original draft: Mohaddeseh Mohsenpour and Fatemeh Aminzare; Review and editing: Mohaddeseh Mohsenpour; Project administration, technical, and material support: All authors.
Conflict of interest
The authors declared no conflict of interest.
References
- Delavari A, Bishehsari F, Salimzadeh H, Khosravi P, Delavari F, Nasseri-Moghaddam S, et al. Adenoma detection rates in an opportunistic screening colonoscopy program in Iran, a country with rising colorectal cancer incidence. BMC Gastroenterol. 2014; 14:196. DOI | PubMed
- Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018; 68(6):394-424. DOI | PubMed
- Ewing I, Hurley JJ, Josephides E, Millar A. The molecular genetics of colorectal cancer. Frontline Gastroenterol. 2014; 5(1):26-30. DOI | PubMed
- Javed Z, Khan K, Sadia H, Raza S, Salehi B, Sharifi-Rad J, et al. LncRNA & Wnt signaling in colorectal cancer. Cancer Cell Int. 2020; 20:326. DOI | PubMed
- Yang T, Zhou H, Liu P, Yan L, Yao W, Chen K, et al. lncRNA PVT1 and its splicing variant function as competing endogenous RNA to regulate clear cell renal cell carcinoma progression. Oncotarget. 2017; 8(49):85353-67. DOI | PubMed
- Ren Y, Huang W, Weng G, Cui P, Liang H, Li Y. LncRNA PVT1 promotes proliferation, invasion and epithelial-mesenchymal transition of renal cell carcinoma cells through downregulation of miR-16-5p. Onco Targets Ther. 2019; 12:2563-75. DOI | PubMed
- Li R, Wang X, Zhu C, Wang K. lncRNA PVT1: A novel oncogene in multiple cancers. Cell Mol Biol Lett. 2022; 27(1):84. DOI | PubMed
- Mangan PR, Harrington LE, O’Quinn DB, Helms WS, Bullard DC, Elson CO, et al. Transforming growth factor-β induces development of the TH17 lineage. Nature. 2006; 441(7090):231-4. DOI | PubMed
- Iglesias M, Frontelo P, Gamallo C, Quintanilla M. Blockade of Smad4 in transformed keratinocytes containing a Ras oncogene leads to hyperactivation of the Ras-dependent Erk signalling pathway associated with progression to undifferentiated carcinomas. Oncogene. 2000; 19(36):4134-45. DOI | PubMed
- Ding J, Li J, Wang H, Tian Y, Xie M, He X, et al. Long noncoding RNA CRNDE promotes colorectal cancer cell proliferation via epigenetically silencing DUSP5/CDKN1A expression. Cell Death Dis. 2017; 8(8):e2997. DOI | PubMed
- Li DX, Fei XR, Dong YF, Cheng CD, Yang Y, Deng XF, et al. The long non-coding RNA CRNDE acts as a ceRNA and promotes glioma malignancy by preventing miR-136-5p-mediated downregulation of Bcl-2 and Wnt2. Oncotarget. 2017; 8(50):88163-78. DOI | PubMed
- Berghoff EG, Clark MF, Chen S, Cajigas I, Leib DE, Kohtz JD. Evf2 (Dlx6as) lncRNA regulates ultraconserved enhancer methylation and the differential transcriptional control of adjacent genes. Development. 2013; 140(21):4407-16. DOI | PubMed
- Yin D, He X, Zhang E, Kong R, De W, Zhang Z. Long noncoding RNA GAS5 affects cell proliferation and predicts a poor prognosis in patients with colorectal cancer. Med Oncol. 2014; 31(11):253. DOI | PubMed
- Takahashi Y, Sawada G, Kurashige J, Uchi R, Matsumura T, Ueo H, et al. Amplification of PVT-1 is involved in poor prognosis via apoptosis inhibition in colorectal cancers. Br J Cancer. 2014; 110(1):164-71. DOI | PubMed
- Zhang X, Feng W, Zhang J, Ge L, Zhang Y, Jiang X, et al. Long non coding RNA PVT1 promotes epithelial mesenchymal transition via the TGF β/Smad pathway in pancreatic cancer cells. Oncol Rep. 2018; 40(2):1093-102. DOI | PubMed
- Chen J, Yu Y, Li H, Hu Q, Chen X, He Y, et al. Long noncoding RNA PVT1 promotes tumor progression by regulating the miR-143/HK2 axis in gallbladder cancer. Mol Cancer. 2019; 18(1):33. PubMed
- Chang Z, Cui J, Song Y. Long noncoding RNA PVT1 promotes EMT via mediating microRNA-186 targeting of Twist1 in prostate cancer. Gene. 2018; 654:36-42. DOI | PubMed
- Zhao L, Kong H, Sun H, Chen Z, Chen B, Zhou M. LncRNA‐ PVT1 promotes pancreatic cancer cells proliferation and migration through acting as a molecular sponge to regulate miR‐448. J Cell Physiol. 2018; 233(5):4044-55. DOI | PubMed
- Becerril-Rico J, Alvarado-Ortiz E, Toledo-Guzmán ME, Pelayo R, Ortiz-Sánchez E. The cross talk between gastric cancer stem cells and the immune microenvironment: A tumor-promoting factor. Stem Cell Res Ther. 2021; 12(1):498. DOI
- Xie F, Ling L, Van Dam H, Zhou F, Zhang L. TGF-β signaling in cancer metastasis. Acta Biochim Biophys Sin (Shanghai). 2018; 50(1):121-32. DOI | PubMed
- Fan H, Zhu JH, Yao XQ. Long non-coding RNA PVT1 as a novel potential biomarker for predicting the prognosis of colorectal cancer. Int J Biol Markers. 2018; 33(4):415-22. DOI | PubMed
- David CJ, Huang YH, Chen M, Su J, Zou Y, Bardeesy N, et al. TGF-β tumor suppression through a lethal EMT. Cell. 2016; 164(5):1015-30. DOI | PubMed
- Rodrigues-Junior DM, Moustakas A. Unboxing the network among long non-coding RNAs and TGF-β signaling in cancer. Ups J Med Sci. 2024; 129. DOI | PubMed