1. Introduction
Streptococcus agalactiae, the only known member of group B streptococci, was initially differentiated from other streptococci by Rebecca Lancefield in the 1930s after being isolated from milk and cows with bovine mastitis [ 1 ]. This bacterium causes mastitis in cows and pneumonia and meningitis in human infants [ 2 , 3 ].
In cases of mastitis, the genus Streptococcus accounts for 25-50% of the isolated pathogens worldwide [ 4 ]. Meanwhile, S. agalactiae is a significant cause of mastitis in cows. S. agalactiae can persist in the mammary gland for extended periods without causing symptoms, and the disease progresses slowly [ 5 , 6 ]. S. agalactiae is transmitted through infected mammary glands and contaminated environmental sources, such as milking machines and bedding [ 2 ]. S. agalactiae infection in dairy cows is a major factor in reducing milk production and the quality of milk products. Milk from cows with mastitis reduces the quality of dairy products. Changes in milk composition not only decrease its nutritional value and cause processing issues but also shorten the shelf life of liquid milk products [ 5 , 7 , 8 ].
The pathogenicity of S. agalactiae depends on the production of a large number of virulence factors, each encoded by different genes. For instance, the virulence factors alpha protein C, beta protein C, hyaluronidase, CAMP factor, and B-hemolysin are encoded by bca, bac, hylB, cfb, and cylE genes, respectively. These virulence genes were reported in some S. agalactiae obtained from mastitis milk samples [ 9 , 10 ]. Previously, Ahmadi et al. (2009) in Urmia, Iran and Momtaz et al (2012) in Isfahan, Iran detected S. agalactiae in milk samples using PCR method [ 11 , 12 ].
The most common treatment for mastitis involves administering intramammary antibiotics in the infected parts of the udder and injection [ 13 ]. However, the overuse of antibiotics to treat mastitis over a long period can lead to antibiotic resistance. This can result in the need to increase antibiotic dosages, leading to the accumulation of high levels of antibiotics in milk and dairy products, which can then be transferred to humans [ 14 ]. Antibiotic resistance has been described as one of the most significant global threats of the 21st century for this reason [ 15 ]. Therefore, it is crucial to determine antibiotic resistance in bacteria isolated from mastitis cases for effective treatment of this disease [ 16 ].
Therefore, this study aimed to determine antibiotic resistance and describe the distribution of virulence genes in isolates to support in the prevention and control of bovine mastitis.
2. Materials and Methods
2.1. Collection of isolates of S. agalactiae and 16S rRNA sequence analysis
30 isolates of S. agalactiae were isolated from 400 milk samples collected from mastitis-affected cows in 10 herds in industrial cattle farms in Alborz and Tehran provinces. The isolates were provided by the Mabna Laboratory, located in Mehrshahr, Karaj, Alborz, Iran. The samples were frozen in 30 microtubes with a size of 2 mL containing 1% glycerol and paraffin at -20 ˚C, then transferred to Karaj Branch of Islamic Azad University Research Laboratory. All S. agalactiae isolates were confirmed using 16S rRNA polymerase chain reaction (PCR).
2.2. Analysis of antimicrobial susceptibility
All confirmed isolates underwent susceptibility testing for 10 commonly used antimicrobial agents in Tehran and Alborz provinces dairy farms The antibiotics tested included erythromycin (15 μg), ceftiofur (30 μg), penicillin (10 μg), ciprofloxacin (5 μg), streptomycin (10 μg), kanamycin (30 μg), tetracycline (30 μg), neomycin (30 μg), florfenicol (30 μg), and clindamycin (2 μg). Susceptibility was assessed using the disc diffusion method on Mueller-Hinton agar plates, supplemented with 5% sheep blood. The cultures were incubated overnight (16–18 h) at 37˚C in an atmosphere containing 5% CO2.
2.3. Genomic DNA extraction
Template DNA was obtained by boiling bacterial colonies. Therefore, each bacterial isolate was cultured in 2 mL of Muller- Hinton broth, then transferred to 2 mL microtubes, and centrifuged (Hermle Z233MK-2) at 5000 rpm (2374×g) for 10 minutes. Then the supernatant was discarded, and 200 microliters of distilled water was added to the remaining sediment. Then the microtubes were placed in the hot block (Techne-DB.2D) for 10 minutes at 100 °C to disrupt the bacterial walls and release the bacterial genome. The microtubes were once again placed in a centrifuge at 5000 rpm (2374×g) for 10 minutes. Ultimately, the liquid supernatant was utilized as the genomic DNA.
2.4. Detection of virulence genes
All confirmed isolates were screened for the presence of the following virulence genes: bac (C-β protein), bca (C- α protein), cfb (CAMP factor), cylE (β-hemolysins/cytolysin) and hylB (hyaluronidase) [ 9 , 17 ].
The concentrations of components in the reaction mixtures used for amplifying gene fragments were selected based on experimental results and references shown in Table 1. For each gene, 12.5 μL of 2x Taq DNA Polymerase Master Mix RED with 1.5 mM MgCl2 (Ampliqon Co. Denmark), 0.5 μL of each primer (0.4 μM for bca), and 1 μL of template DNA were placed in each microtube. Then the total volume of each microtube reached 25 μL with distilled water. Each reaction included a positive control (DNA isolate containing the tested gene) and a negative control (nuclease-free water) in a thermocycler (Applied Biosystems- en61327). The primer sequences and conditions used for amplification of DNA fragments are presented in Table 1. Also, PCR temperatures and conditions are shown in footnotes of the Table 1.
| Gene | Primer Sequence (5’⟶ 3’) | Amplicon Size (bp) | Ref. |
|---|---|---|---|
| 16S-23S rRNA11 | Fw: TGTTTAGTTTTGAGAGGTCTTG | 150 | [ 16 ] |
| Rv: CGTGGAATTTGATATAGATATTC | |||
| 16S-23S rRNA21 | Fw: GGAAACCTGCCATTTGCG | 281 | [ 16 ] |
| Rv: TAACTTAACCTTATTAACCTAG | |||
| bac2 | Fw: AAGCAACTAGAAGAGGAAGC | 479 | [ 16 ] |
| Rv: TTCTGCTCTGGTGTTTTAGG | |||
| bca3 | Fw: TGATACTTCACAGACGAAACAACG | 398 | [ 16 ] |
| Rv: TACATGTGGTAGTCCATCTTCACC | |||
| cfb4 | Fw: TTTCACCAGCTGTATTAGAAGTA | 153 | [ 16 ] |
| Rv: GTTCCCTGAACATTATCTTTGAT | |||
| cylE5 | Fw: CATTGCGTAGTCACCTCCC | 380 | [ 17 ] |
| Rv: GGGTTTCCACAGTTGCTTGA | |||
| hylB2 | Fw: CACCAATCCCCACTCTACTA | 444 | [ 16 ] |
| Rv: TGTGTCAAACCATCTATCAG | |||
| 194 °C (600 s); 30 cycles of 94 °C (60 s), 55 °C (60 s), 72 °C (60 s); final extension 72 °C (420 s). | |||
| 294 °C (300 s); 30 cycles of 94 °C (30 s), 53°C (30 s), 72 °C (60 s); final extension 72 °C (240 s). | |||
| 396 °C (180 s); 30 cycles of 95 °C (60 s), 58°C (45 s), 72 °C (45 s); final extension 72 °C (600 s) | |||
| 494 °C (180 s); 40 cycles of 95 °C (20 s), 55 °C(30 s), 72 °C (120 s); final extension 72 °C (300 s) | |||
| 594 °C (180 s); 34 cycles of 94 °C (20 s), 56 °C (20 s), 72 °C (45 s); final extension 72 °C (300 s) | |||
3. Results
3.1. Antimicrobial susceptibility
Antimicrobial susceptibility testing of the isolates showed that 100% of the 24 confirmed isolates (Unconfirmed isolates are number 2, 8, 10, 25, 26, and 30) of S. agalactia were susceptible to penicillin, ciprofloxacin, and ceftiofur, and 75% were susceptible to florfenicol. All 24 isolates were resistant to the streptomycin, kanamycin, tetracycline, and neomycin. The resistance rates for clindamycin and erythromycin were 95.8% and 91.6%, respectively (Table 2).
| Antibiotic Resistance and | Patterns | No. (%) of Isolates |
|---|---|---|
| Antibiotics resistance patterns | N, CC, FF, TE, E, K, ST | 3(12.5) |
| N, CC, TE, E, K, ST | 19(79.16) | |
| N, CC, TE, K, ST | 1(4.16) | |
| N, TE, K, ST | 1(4.16) | |
| Virulence gene profile | cylE | 1(4.16) |
| cfb, hylB | 23(95.83) | |
| cfb, hylB, cylE | 6(25) | |
| Abbreviations: N: Neomycin; CC: Clindamycin; FF: Florfenicol; TE: Tetracycline; E: Erythromycin; ST: Streptomycin. | ||
3.2. Prevalence of virulence genes
The presence of five virulence genes of S. agalactiae (bca, cylE, cfb, hylB, and bac) were tested in all 24 confirmed isolates, shown in Figures 1, 2, 3, 4, 5, and 6. The results showed that cfb and hylB genes were detected in 95.8% of S. agalactiae isolates. Also, cylE gene was detected in 29.1% of these isolates, while the bac and bca genes were not detected in these isolates. Three distinct virulence gene profiles were identified and the virulence gene profile cfb-hylB was common among isolates, as shown in Table 2.
Figure 1.hylB gene specific PCR for S. agalactiae (444 bp)Note: First lane: Ladder; The last lane: Nuclease-free water as negative control, lanes 1 to 14 relates to samples 1 to 14 that isolated from clinical bovine mastitis (Lane 2 relates to isolate that is Unconfirmed).
Figure 2.hylB gene specific PCR for S. agalactiae (444 bp)Note: First lane: Ladder; Lane 15 to 29 relates to samples 15 to 29 that isolated from clinical bovine mastitis.
Figure 3.cylE gene specific PCR for S. agalactiae (380 bp)Note: First lane: Ladder; The last lane: Nuclease-free water as negative control, lanes 1 to 14 relates to samples 1 to 14 that isolated from clinical bovine mastitis (lane 2 relates to isolate that is unconfirmed).
Figure 4.cylE gene specific PCR for S. agalactiae (380 bp)First lane: Ladder; Lane 15 to 29 relates to samples 15 to 29 that isolated from clinical bovine mastitis.
Figure 5.cfb gene specific PCR for S. agalactiae (153 bp)Note: First lane: Ladder; The last lane: Nuclease-free water as negative control, lanes 1 to 14 relates to samples 1 to 14 that isolated from clinical bovine mastitis (lane 2 relates to isolate that is Unconfirmed).
Figure 6.cfb gene specific PCR for S. agalactiae (153 bp)Note: First lane: Ladder; Lane 15 to 29 relates to samples 15 to 29 that isolated from clinical bovine mastitis.
4. Discussion
S. agalactiae is considered one of the major mastitis pathogens. To the best of our knowledge, this is one of the first molecular studies that characterizes S. agalactiae isolates circulating among cattle with mastitis in Tehran and Alborz provinces, Iran. Of the 30 original strains identified as S. agalactiae by biochemical tests, only 24 were confirmed genetically, resulting in an isolation rate of 80.0%. The presence of virulence factors in a pathogen significantly influences disease progression [ 9 ]. Concerning the virulence genes screened in this study, five virulence genes were detected, including bac, bca, cfb, hylB, and cylE.
The hylB gene encodes the hyaluronidase protein [ 18 ], an enzyme that increases the spread of infection by hydrolyzing hyaluronic acid in the connective tissue [ 19 , 20 ]. In previous studies, the frequency of hylB virulence gene has been reported in more than 95% of the investigated isolates [ 7 , 18 - 24 ]. In this study, the virulence gene hylB was seen in 23 of the 24 confirmed isolates of S. agalactiae (95.83%), highlighting its importance in improving mastitis by S. agalactiae.
The cfb virulence gene encodes the CAMP factor, which induces pore formation in host cell membrane [ 9 , 18 ]. Most studies have reported a frequency above 90% in most researches [ 7 , 9 , 18 , 19 , 21 , 24 - 26 ]. The next reported frequency was 68.96% and the lowest frequency of this gene was 38.09% [ 27 ]. With these interpretations, we can conclude that this virulence gene is also one of the most abundant virulence genes of S. agalactiae. In this research, cfb virulence gene was founded in all isolates but one (95.83%).
The virulence gene cylE, by encoding the B-hemolysin protein, increases the invasion of this bacterium into host cells [ 9 ]. Different frequencies have been reported in different countries for this virulence gene. The highest frequency reported for the cylE virulence gene was 100% [ 19 - 21 ]. Also, in some researches, the frequency of this gene has been reported as 93% [ 18 , 26 ]. Frequencies of 78% and 68.2% were reported [ 9 , 22 ]. The lowest mentioned frequency for this gene was 23.80% [ 27 ]. In this research, cylE virulence gene was found in 7 isolates out of 24 confirmed isolates of S. agalactiae (29.16%). According to the clinical reports, the cows affected with these isolates showed sever clinical mastitis.
Among the reviewed articles from various countries, the bca and bac virulence genes have the lowest frequency of occurrence. The virulence gene, bca, encodes surface protein C alpha antigen. This protein mediates the adhesion of bacteria to the epithelial cells of the host. The bac virulence gene encodes surface protein C beta antigen, responsible for binding to immunoglobulin A [ 9 ]. In most studies, the frequency of the bca and bac virulence genes was less than 10% and, in some cases, even 0% [ 7 , 9 , 18 - 21 , 25 ]. In this study, bac and bac virulence genes were not found in any of the 24 confirmed isolates of S. agalactiae (0%). This can be related to the relatively small samples size collected in this study.
These results indicated that the bac and bca virulence genes probably do not significantly contribute to the pathogenesis of mastitis caused by S. agalactiae in dairy cows, and these two genes are less important in the virulence of S. agalactiae than the virulence genes hylB, cylE, and cfb. It can be concluded that the hylB and cfb genes play a significant role in the pathogenesis of mastitis caused by S. agalactiae in dairy cows.
The most common treatment for mastitis involves administering antibiotics directly into the infected parts of udder and giving intramuscular injections [ 13 ]. In this study, we conducted susceptibility testing for 10 commonly used antibiotics to treat clinical mastitis in dairy cows in Tehran and Alborz Provinces. We found that all 24 isolates showed 100% resistance rate to streptomycin, neomycin, tetracycline, and kanamycin, while they ex-hibited high sensitivity to penicillin, ciprofloxacin, and ceftiofur. Also, the resistance rate in 24 isolates was over than 90% for clindamycin and erythromycin and it was 12.5% for florfenicol.
The results of this study indicate that penicillin, ciprofloxacin, and ceftiofur, may be suitable drug choices for treating S. agalactiae mastitis in the of Tehran and Alborz Provinces. However, S. agalactiae can eventually develop resistance to these antimicrobial agents. Therefore, these three antibiotics should not be considered a long-term solution. Also, the virulence genes investigated in this study can provide helpful data for the preparation of vaccines for use in livestock in the Tehran and Alborz provinces. We detected several virulence profiles associated with S. agalactiae intramammary infections.
5. Conclusion
Overall, the findings suggest that bac and bca virulence genes probably do not significantly contribute to the pathogenesis of mastitis caused by S. agalactiae in dairy cows, although this can be influenced by the relatively small size of the samples collected in this study. Also, the hylB and cfb genes play a significant role in the pathogenesis of mastitis caused by S. agalactiae in dairy cows. On the other hand, according to the results of the disk diffusion test, we have determined that penicillin, ciprofloxacin, and ceftiofur are the most effective antibiotics for treating mastitis caused by S. agalactiae. These data will assist us in closely monitoring S. agalactiae strains, improving diagnostic methods, and developing prevention, treatment strategies including the potential for vaccine production.
Acknowledgements
A collection of S. agalactia isolates investigated in this study was gathered by the Mabna laboratory in March and April 2024.
Compliance with ethical guidelines
All experimental procedures were carried out in accordance with established the ethical research, ensuring the welfare and safety of the participants.
Data availability
The data supporting the findings of this study are available upon request from the corresponding author.
Funding
This research did not receive any grant from funding agencies in the public, commercial, or non-profit sectors.
Authors' contributions
Conceptualization and study design: Hadi Pourtaghi; Data acquisition: Fatemeh Hashemi Haghighi and Farhad Moosakhani; Experiments and data interpretation: Hadi Pourtaghi, Fatemeh Hashemi Haghighi, Naser Harzandi, and Farhad Moosakhani; Writing the original draft: Fatemeh Hashemi Haghighi; Review and editing: Hadi Pourtaghi and Naser Harzandi; Supervision, project administration, technical, and material support: Hadi Pourtaghi, Naser Harzandi, and Farhad Moosakhani.
Conflict of interest
The authors declared no conflict of interest.
References
- Lancefield RC. A serological differentiation of human and other groups of hemolytic streptococci. J Exp Med. 1933; 57(4):571-95. DOI | PubMed
- Ruegg PL. A 100-Year Review: Mastitis detection, management, and prevention. J Dairy Sci. 2017; 100(12):10381-97. DOI | PubMed
- Lin C, Chu SM, Wang HC, Yang PH, Huang HR, Chiang MC, et al. Complicated Streptococcus agalactiae sepsis with/without meningitis in young infants and newborns: The clinical and molecular characteristics and outcomes. Microorganisms. 2021; 9(10):2094. DOI | PubMed
- Kabelitz T, Aubry E, van Vorst K, Amon T, Fulde M. The role of Streptococcus spp. in bovine mastitis. Microorganisms. 2021; 9(7):1497. DOI | PubMed
- Cobo-Ángel C, Jaramillo-Jaramillo AS, Lasso-Rojas LM, Aguilar-Marin SB, Sanchez J, Rodriguez-Lecompte JC, et al. Streptococcus agalactiae is not always an obligate intramammary pathogen: Molecular epidemiology of GBS from milk, feces and environment in Colombian dairy herds. Plos One. 2018; 13(12):e0208990. DOI | PubMed
- Cobirka M, Tancin V, Slama P. Epidemiology and classification of mastitis. Animals. 2020; 10(12):2212. DOI | PubMed
- Carvalho-Castro GA, Silva JR, Paiva LV, Custódio DA, Moreira RO, Mian GF, et al. Molecular epidemiology of Streptococcus agalactiae isolated from mastitis in Brazilian dairy herds. Braz J Microbiol. 2017; 48(3):551-9. DOI | PubMed
- Lakew BT, Fayera T, Ali YM. Risk factors for bovine mastitis with the isolation and identification of Streptococcus agalactiae from farms in and around Haramaya district, eastern Ethiopia. Trop Anim Health Prod. 2019; 51:1507-13. DOI | PubMed
- Kaczorek E, Małaczewska J, Wójcik R, Siwicki AK. Biofilm production and other virulence factors in Streptococcus spp. isolated from clinical cases of bovine mastitis in Poland. BMC Vet Res. 2017; 13:1-7. DOI | PubMed
- Lindahl G, Stålhammar-Carlemalm M, Areschoug T. Surface proteins of Streptococcus agalactiae and related proteins in other bacterial pathogens. CMR. 2005; 18(1):102-27. DOI | PubMed
- Ahmadi M, Razavi RS, Ayremlou N. Evaluation of Streptococcus agalactiae detection by PCR in milk and its comparison to other microbiological methods. Iran J Microbiol. 2009; 28-31. https://ijm.tums.ac.ir/index.php/ijm/article/view/36
- Momtaz H, Seyed Froutan M, Taktaz T, Sadeghi M. Molecular detection of Streptococcus uberis and Streptococcus agalactiae in the mastitic cows milks in Isfahan province. J Microb Biol. 2012; 1(2):71-6. https://bjm.ui.ac.ir/article_19461.html?lang=e
- Barkema HW, Schukken YH, Zadoks RN. Invited review: The role of cow, pathogen, and treatment regimen in the therapeutic success of bovine Staphylococcus aureus mastitis. J Dairy Sci. 2006; 89(6):1877-95. DOI | PubMed
- White DG, McDermott PF. Emergence and transfer of antibacterial resistance. J Dairy Sci. 2001; 84:E151-5. DOI
- Conly JM, Johnston BL. Where are all the new antibiotics? The new antibiotic paradox. Can J Infect Dis Med Microbiol. 2005; 16(3):159. DOI | PubMed
- Boireau C, Cazeau G, Jarrige N, Calavas D, Madec JY, Leblond A, et al. Antimicrobial resistance in bacteria isolated from mastitis in dairy cattle in France, 2006-2016. J Dairy Sci. 2018; 101(10):9451-62. DOI | PubMed
- Kannika K, Pisuttharachai D, Srisapoome P, Wongtavatchai J, Kondo H, Hirono I, et al. Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR. J Appl Microbiol. 2017; 122(6):1497-507. DOI | PubMed
- Zastempowska E, Twarużek M, Grajewski J, Lassa H. Virulence factor genes and cytotoxicity of Streptococcus agalactiae isolated from bovine mastitis in Poland. Microbiol Spectr. 2022; 10(3):e02224-21. DOI | PubMed
- Han G, Zhang B, Luo Z, Lu B, Luo Z, Zhang J, et al. Molecular typing and prevalence of antibiotic resistance and virulence genes in Streptococcus agalactiae isolated from Chinese dairy cows with clinical mastitis. Plos One. 2022; 17(5):e0268262. DOI | PubMed
- Hernandez L, Bottini E, Cadona J, Cacciato C, Monteavaro C, Bustamante A, et al. Multidrug resistance and molecular characterization of Streptococcus agalactiae isolates from dairy cattle with mastitis. Front Cell Infect Microbiol. 2021; 11:647324. DOI | PubMed
- Lin L, Huang X, Yang H, He Y, He X, Huang J, et al. Molecular epidemiology, antimicrobial activity, and virulence gene clustering of Streptococcus agalactiae isolated from dairy cattle with mastitis in China. J Dairy Sci. 2021; 104(4):4893-903. DOI | PubMed
- Abd El KA, Arafa AA, Fouad EA, Younes AM, Almuzaini AM, Abdou AM. Isolation, identification and virulence determinants of Streptococcus agalactiae from bovine subclinical mastitis in Egypt. J IDC. 2021; 15(08):1133-8. DOI | PubMed
- Bonsaglia EC, Rossi RS, Latosinski G, Rossi BF, Campos FC, Junior AF, et al. Relationship between biofilm production and high somatic cell count in streptococcus agalactiae isolated from milk of cows with subclinical mastitis. Pathogens. 2023; 12(2):311. DOI | PubMed
- Zhang Z, Yang F, Li XP, Luo JY, Liu LH, Wang D, et al. Distribution of serotypes, antimicrobial resistance and virulence genes among Streptococcus agalactiae isolated from bovine in China. Acta Sci Vet. 2019; 47DOI
- Wataradee S, Boonserm T, Samngamnim S, Ajariyakhajorn K. Characterization of virulence factors and antimicrobial susceptibility of Streptococcus agalactiae associated with bovine mastitis cases in Thailand. Animals. 2024; 14(3):447. DOI | PubMed
- El-Behiry A, Elsayed M, Marzouk E, Bathich Y. Detection of virulence genes in Staphylococcus aureus and Streptococcus agalactiae isolated from mastitis in the Middle East. Br Microbiol Res J. 2015; 10(3):1-9. DOI
- Parasana DK, Javia BB, Fefar DT, Barad DB, Ghodasara SN. Detection of virulence associated genes in Streptococcus agalactiae isolated from bovine mastitis. Iran J Vet Res. 2022; 23(3):275. https://ijvr.shirazu.ac.ir/article_6822.html