Distribution of Mupirocin Resistance in Nasal Carriers of Methicillin-resistant Staphylococcus aureus Among ICU Healthcare Workers and Patients in Rasht, Iran

Document Type : Original Articles

Authors

1 ENT and Head and Neck Research Center and Department, The Five Senses Health Institute, School of Medicine, Iran University of Medical Sciences (IUMS), Tehran, Iran.

2 Department of Microbiology, School of Medicine, Guilan University of Medical Sciences, Rasht, Iran.

3 Department of Microbiology, School of Medicine, Iran University of Medical Sciences, Tehran, Iran.

Abstract

Introduction: Methicillin-resistant Staphylococcus aureus (MRSA) represents a significant public health concern, contributing to infections in both community settings and clinical environments. Healthcare professionals, in particular, demonstrate elevated rates of MRSA colonization. This research focused on assessing the resistance to mupirocin prevalence among nasal MRSA carriers in intensive care unit (ICU) healthcare workers.
Materials & Methods: Nasal swabs were obtained from hospitalized patients and healthcare staff, and S. aureus was identified through biochemical and microbiological tests. Antibiograms were conducted on isolated strains, employing a 30 μg cefoxitin disc for MRSA detection, while mupirocin resistance was identified using the disc-diffusion technique (Kirby-Bauer method). The minimum inhibitory concentration (MIC) for mupirocin, as well as the detection of the mupA and mupB genes, was accomplished by polymerase chain reaction (PCR).
Results: Of the 81 S. aureus isolates collected from nasal carriers, 20(24.69%) originated from ICU staff, while 61(75.31%) were from patients. MRSA constituted 77.7% (63/81) of the isolates overall. High-level resistance to mupirocin was detected in 34.56% (28/81) of isolates when tested with a 200 µg mupirocin disc, with the mupA gene detected in the same proportion of isolates. Notably, no low-level mupirocin resistance or mupB gene presence was identified in this study. Resistance rates to other antibiotics included rifampin (74.07%), penicillin (87.65%), amikacin (34.56%), gentamicin (56.79%), tetracycline (83.95%), erythromycin (100%), and clindamycin (100%). No resistance was observed for linezolid or Synercid.
Conclusion: The study revealed higher mupirocin resistance among healthcare workers compared to patients, underscoring the need for regular screening of healthcare staff and comprehensive antibiotic resistance profiling to mitigate MRSA transmission within hospital settings.

Keywords

Main Subjects


1. Introduction

Staphylococcus aureus represents a prominent cause of infections acquired in both community and healthcare settings. Its ability to colonize the skin and nasal passages makes it a significant contributor to various clinical conditions [ 1 ]. One of the primary difficulties in managing these infections is the increasing prevalence of antibiotic resistance, particularly MRSA. Resistance to methicillin is facilitated through the expression of penicillin-binding protein 2a (PBP2a), which reduces the efficacy of β-lactam antibiotics. The initial detection of MRSA occurred in the United Kingdom in 1961, and since then, MRSA has emerged as a significant worldwide public health concern. Infections caused by MRSA often result in prolonged hospital stays due to their severity. Transmission primarily occurs through direct contact, with healthcare workers and contaminated medical equipment serving as key vectors. Approximately 40 - 60 percent of infections acquired in healthcare setting are attributed to healthcare workers, who, along with patients carrying MRSA in their nasal passages, pose a risk of spreading the pathogen to other hospitalized individuals, especially in intensive care units (ICUs) [ 2 ]. Mupirocin, also known as pseudomonic acid A or Bactroban, is an essential antibiotic for treating various staphylococcal skin infections. It is minimally absorbed systemically and is excreted primarily via urine. Mupirocin disrupts bacterial protein production by competitively inhibiting the enzyme isoleucyl-tRNA synthetase. The U.S. Food and Drug Administration recommends its use as a nasal topical formulation to eradicate S. aureus nasal carriage among adult patients and healthcare workers [ 3 ]. Despite mupirocin’s critical role in managing S. aureus infections, there remains a significant gap in research regarding mupirocin resistance in northern Iran. This study seeks to fill this void by investigating the prevalence of resistance to mupirocin among nasal carriers of S. aureus, focusing on healthcare workers and patients across three ICUs in the region.

2. Materials and Methods

2.1. Study design and setting

Nasal swab specimens were collected from both ICUadmitted patients and healthcare staff at two academic medical centers (Velayat and Poursina Hospitals) in Rasht, Iran. Prior to sample collection, every contributor was comprehensively briefed on the aims of the study and provided written consent. The detection of S. aureus was carried out through a series of biochemical and microbiological tests, including gram staining, coagulase and catalase tests, DNase activity assays, and growth and fermentation analysis on Mannitol salt agar plates.

2.2. Phenotypic identification of MRSA and mupirocin resistant S. aureus

To identify MRSA isolates, a 30 μg cefoxitin disc (Mast Group, Ltd, U.K.) was employed as a reliable surrogate marker for methicillin resistance detection. Additionally, mupirocin resistance was assessed using discs with concentrations of 5 μg and 200 μg (Mast Group, Ltd, U.K.), with isolates cultured on Mueller-Hinton agar (Merck, Germany) following the Kirby-Bauer disk diffusion method. After a 24-hour incubation at 37 °C, results were interpreted based on the guidelines established in the Clinical and Laboratory Standards Institute (CLSI) [ 4 ] reference tables.

2.3. Determination of minimal inhibitory concentration (MIC)

The established protocols for E-test strips (AB Biodisk, Solna, Sweden) were used for measuring mupirocin MIC. Isolates were categorized as susceptible when demonstrating MIC values ≤4 mg/L. Mupirocin resistance was further divided into two categories: Low-level resistance (MIC range: 8–256 mg/L) and high-level resistance (MIC ≥512 mg/L). The reference strain S. aureus ATCC 29213 was utilized for quality assurance, and all findings were evaluated according to the guidelines established by the CLSI [ 4 ] breakpoints.

2.4. Antimicrobial susceptibility testing

The antibiotic resistance patterns of the isolates were evaluated through the standardized Kirby-Bauer disc diffusion method, with antibiotic discs procured from Mast Company (United Kingdom). The susceptibility of all MRSA isolates was tested against rifampin (AP; 10 μg), Synercid (quinupristin-dalfopristin) (K; 30 μg), clindamycin (CD; 2 μg), erythromycin (E; 15 μg), linezolid (LZD; 30 μg), penicillin (PG; 10 μg), amikacin (AK; 30 μg), gentamicin (GM; 10 μg), tetracycline (T; 30 μg), and cefoxitin (30 μg). Testing was conducted on Mueller-Hinton agar in accordance with the protocols set forth by the CLSI [ 4 ]. The standard strain S. aureus ATCC 25923 was incorporated in each testing cycle to ensure accuracy and reliability of the results.

2.5. MRSA and mupirocin-resistant S. aureus

The polymerase chain reaction (PCR) amplification mixture contained 12 μL of PCR master mix, 10 pmol of each primer (specific sequences listed in Table 1), and 50–200 ng of template DNA obtained through extraction. Sterile double-distilled water was incorporated to attain the final reaction volume of 25 μL. The thermal cycling protocol comprised an initial denaturation phase at 94 °C (10 minutes), followed by 35 amplification cycles (94 °C for 1 minute denaturation, 45 °C for 1 minute primer annealing, and 72 °C for 75 seconds extension), concluding with a terminal extension step at 72 °C for 10 minutes.

Target Primer Sequence (5′ → 3′) Product Size (bp) Ref.
mecA F TGGCTATCGTGTCACAATCG 304 [ 6 ]
R CTGGAACTTGTTGAGCAGAG
mupA F TATATTATGCGATGGAAGGTTGG 457 [ 6 ]
R AATAAAATCAGCTGGAAAGTGTTG
mupB F CTAGAAGTCGATTTTGGAGTAG 674 [ 6 ]
R AGTGTCTAAAATGATAAGACGATC
Table 1.Oligonucleotide primer sequences and specifications employed in molecular analyses

Additionally, the mecA gene, along with the mupA and mupB genes, was amplified to identify MRSA and mupirocin-resistant S. aureus strains, respectively (Table 1). The amplification conditions for these genes were similar to those described above, except for the annealing temperatures: 55 °C for mecA and 60 °C for both mupA and mupB. The PCR amplicons were examined using electrophoretic technique at 100V on 1.5% agarose gel and visualized under a UV transilluminator.

2.6. Statistics

Based on sample size and data distribution, SPSSTM version 26.0 (IBM Corp, USA) used for statistical analyses by applying either chi-square or Fisher’s exact tests. Statistical significance was defined as a P<0.05.

3. Results

Among the 81 S. aureus isolates obtained from the nasal carriage of healthcare workers and patients, 20(24.69%) were sourced from ICU staff, while 61(75.31%) were derived from patients. Additionally, 25 of the 81 isolates (30.86%) were collected from Velayat Hospital (burn hospital), and 56 of the 81(69.14%) were obtained from Poursina Hospital. The overall prevalence of MRSA isolates was 77.7% (63 out of 81). Among the 20 isolates collected from ICU staff, 90% (18 isolates) were identified as MRSA, and 10% (2 isolates) were methicillinsensitive S. aureus (MSSA). The results from the disc diffusion method were consistent with PCR amplification of the mecA gene.

The antibacterial susceptibility tests revealed that 34.56% (28 out of 81 isolates) of the strains exhibited high-level mupirocin resistance, as determined using a 200 μg mupirocin disc. Among these mupirocin-resistant S. aureus isolates, 64.28% (18 out of 28 isolates) were collected from patients, and 35.72% (10 out of 28 isolates) were collected from healthcare staff. According to CLSI guidelines, a 200 μg mupirocin disc is used to detect isolates with high-level mupirocin resistance.

3.1. Detection of mupA and mupirocin resistance

The mupA gene, responsible for mediating high-level resistance to mupirocin, was detected in 34.56% (28 out of 81) of the mupirocin-resistant S. aureus isolates. High-level mupirocin resistance was assessed using 200 μg discs, whereas 5 μg discs were used to detect lowlevel resistance. Notably, neither low-level mupirocinresistant isolates nor the mupB gene were identified in this study. The mupB gene is typically used in conjunction with other targeted primers to identify high-level mupirocin resistance.

Among the 81 isolates analyzed, 34.56% (28 isolates) exhibited a MIC of mupirocin ≥512 μg/mL, categorizing them as high-level mupirocin-resistant. Conversely, no isolates demonstrated low-level mupirocin resistance.

3.2. Antibiotic susceptibility profile

All isolates demonstrated susceptibility to linezolid and Synercid. In contrast, all isolates exhibited resistance to erythromycin and clindamycin. The susceptibility rates for other antibiotics were as follows: Rifampin (74.07%, 60/81), penicillin (87.65%, 71/81), amikacin (34.56%, 28/81), gentamicin (56.79%, 46/81), and tetracycline (83.95%, 68/81).

4. Discussion

S. aureus represents a highly pathogenic microorganism capable of causing diverse clinical manifestations, ranging from localized cutaneous infections to lifethreatening systemic conditions such as joint infections, heart valve inflammation, bone infections, and bloodstream infections. This bacterium commonly colonizes the skin and passages, particularly among healthcare workers, where it serves as a significant reservoir for infection transmission to patients, colleagues, and medical equipment [ 5 , 6 ]. In this study, 24.69% (20 staff members) and 75.31% (61 patients) of participants were identified as nasal carriers of S. aureus. These rates surpass those reported in previous studies by Salman et al. (24%), Chen et al. (19.3%), and Boncompain et al. (30%) [ 7 - 9 ]. The prevalence of nasal carriage among healthcare workers and patients varies considerably across regions with differing public health infrastructures. In alignment with this study’s findings (61 out of 81 isolates), research by Conceição et al. (2013) in Portugal and Weterings et al. (2019) in the Netherlands also reported higher nasal carriage rates among staff compared to patients [ 10 , 11 ]. However, additiona research involving expanded sample populations and extended follow-up periods are essential for more definitive conclusions.

MRSA is a significant reason of infections in high-risk populations and is classified into healthcare-acquired (HA-MRSA) and community-acquired (CA-MRSA) strains. Mupirocin remains an effective antibiotic for eradicating MRSA in carriers and managing infections of the skin and underlying soft tissues, highlighting its importance in infection control strategies [ 3 ].

In this study, we employed both phenotypic and molecular methods to identify mupirocin resistance among MRSA isolates obtained from the nasal carriage of healthcare workers and patients. Analysis revealed a MRSA colonization prevalence of 77.7% (63/81) within the studied population. A meta-analysis by Dadashi et al. (2018) reported a comparable frequency of MRSA infections in Iran, although at a lower rate of 43.0% [ 12 ]. The disparity in MRSA prevalence may be attributed to variations in the isolates source, participant demographics, and the specific hospital settings involved.

Resistance to mupirocin among MRSA isolated from nasal carriers was observed to be elevated in patients relative to healthcare workers. A study conducted by Kaur et al. (2014) examined 38 S. aureus strains isolated from healthcare workers in a tertiary care rural hospital, of which 20 were identified as MRSA. Their analysis of resistance levels of mupirocin, using 5 μg discs for low-level resistance and 200 μg discs for high-level resistance, revealed that only two isolates were mupirocinresistant [ 13 ].

The higher prevalence of resistance to mupirocin among healthcare workers might be related to their limited awareness of hand hygiene, contact precautions, and appropriate infection control measures. Mupirocin is commonly employed as a therapeutic agent for diverse cutaneous infections caused by Staphylococcus species. In this investigation, the resistance rate to mupirocin was observed to be 34.56% [ 14 ], which aligns approximately with the 40% documented by Shahsavan et al [ 14 ]. However, significant variability in mupirocin resistance rates has been observed across different studies [ 12 , 15 , 16 ].

Unfortunately, the mupirocin resistance rate in this study was relatively high, likely due to the improper application of mupirocin in treating skin infections. The uncontrolled use of mupirocin has been linked to the development of resistance against it, which presents a significant concern in hospitals, particularly in ICUs. In this study, the rate of mupirocin-resistant S. aureus among MRSA isolates from ICUs was found to be 34.56%.

Notably, the results obtained through the disc diffusion method were consistent with those derived from molecular techniques. In contrast, Kavitha et al. (2019) reported no mupirocin resistance in ICUs; however, their study did not employ molecular methods [ 17 ]. In line with our findings, Rashidi Nezhad et al. documented a high-level mupirocin resistance rate of 41.4% among hospitalized patients in ICUs in Tehran, Iran [ 18 ]. Furthermore, Khandan et al. (2018) reported the presence of nasal colonization by S. aureus in both ICU personnel and patients, which was effectively eradicated using mupirocin ointment [ 19 ]. According to CLSI guidelines, the established method for distinguishing between lowlevel and high-level mupirocin-resistant strains involves determining the MIC and detecting the mupA gene via PCR [ 20 ].

Despite the established methods, some studies have used the disc diffusion technique to differentiate between low-level (5 μg discs) and high-level mupirocin resistance (200 μg discs) among S. aureus isolates [ 12 , 15 , 16 ].

The rising challenge of antibiotic resistance in bacterial infections is significantly increasing mortality rates, prolonging hospital stays, and driving up healthcare costs, thereby imposing a substantial financial strain on national health systems. Methicillin-resistant S. aureus (MRSA) infections, particularly in intensive care units, further complicate the efforts of healthcare providers, affecting both staff and patients [ 21 , 22 ]. Over the past few years, identification of genes responsible for antibiotic resistance genes in S. aureus has been reported across various regions of Iran [ 23 - 25 ]. This trend aligns with global concerns, as antimicrobial resistance has been shown to result in treatment failures, increased resource utilization, and higher healthcare expenditures. For example, studies estimate that infections due to antibioticresistant pathogens cost the U.S. healthcare system more than 2 billion USD annually and contribute to over 4.6 billion USD in costs for treating multidrug-resistant pathogens. The economic and clinical impacts underscore the critical imperative to enhance infection prevention protocols and responsible antibiotic use to combat this escalating threat.

The discrepancies observed across different studies may be result from variations in infection control practices and treatment approaches adopted across different geographical regions [ 26 ].

5. Conclusion

Given that the current study found higher rates of mupirocin resistance among healthcare workers compared to patients, it suggests that mupirocin resistance poses a significant threat in hospital environments. Therefore, routine monitoring of healthcare personnel, combined with continuous evaluation of antibiotic resistance trends, is vital to avert the spread of MRSA within hospitals. Ultimately, our findings indicate that linezolid and quinupristin-dalfopristin (Synercid) could serve as effective alternatives for treating S. aureus infections.

Acknowledgements

The authors would like to express their gratitude to the laboratory staff of the Guilan University of Medical Sciences, Rasht, Iran.

Compliance with ethical guidelines

All ethical guidelines were thoroughly observed during the development of this manuscript.

Data availability

All data generated or analyzed during this study are included in this article.

Funding

Funding for this research was provided by Guilan University of Medical Sciences, Rasht, Iran.

Authors' contributions

Data acquisition, data assessment and elucidation: Hanieh Biglari; Writing the original draft: Pegah Alizadeh Pahlavan; Review and editing: Ali Mojtahedi.

Conflict of interest

The authors declared no conflict of interest.

References

  1. Tong SY, Davis JS, Eichenberger E, Holland TL, Fowler Jr VG. Staphylococcus aureus infections: Epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev. 2015; 28(3):603-61. DOI | PubMed
  2. Al-Nsour EH, Al-Hadithi HT, Al-Groom RM, Abushattal S, Naser AY, Al Nsour AH, et al. Increased incidence of methicillin resistant Staphylococcus aureus and methicillin resistant Staphylococcus epidermidis in the skin and nasal carriage among healthcare workers and inanimate hospital surfaces after the COVID-19 pandemic. Iran J Microbiol. 2024; 16(5):584-97. DOI | PubMed
  3. Premanand B, Thiyagarajan S, Thangavelu S, Mohammed Ali S, George FSA. Prevalence of Mupirocin and Methicillin-Resistant Staphylococcus aureus in Nasal Carriage Among Healthcare Workers in an Intensive Care Unit and Post-decolonization Screening Outcomes at a Tertiary Care Hospital: A Prospective Study. Cureus. 2023; 15(10):e46435. DOI | PubMed
  4. CLSI. Performance standards for antimicrobial susceptibility testing. CLSI guideline M100. Clinical and Laboratory Standards Institute; 2024.
  5. Attia NM. Assessment of mupirocin resistance among clinical isolates of methicillin resistant staphylococcus aureus. Egypt J Med Microb. 2021; 30(1):109-14. https://journals.ekb.eg/article_202193.html
  6. Agarwal L, Singh AK, Sengupta C, Agarwal A. Nasal carriage of Methicillin- and Mupirocin-resistant S. aureus among health care workers in a tertiary care hospital. J Res Pharm Pract. 2015; 4(4):182-6. DOI | PubMed
  7. Salman MK, Ashraf MS, Iftikhar S, Baig MAR. Frequency of nasal carriage of Staphylococcus Aureus among health care workers at a Tertiary Care Hospital. Pak J Med Sci. 2018; 34(5):1181-4. DOI | PubMed
  8. Chen CS, Chen CY, Huang YC. Nasal carriage rate and molecular epidemiology of methicillin-resistant Staphylococcus aureus among medical students at a Taiwanese university. Int J Infect Dis. 2012; 16(11):e799-803. DOI | PubMed
  9. Boncompain CA, Suárez CA, Morbidoni HR. Staphylococcus aureus nasal carriage in health care workers: First report from a major public hospital in Argentina. Rev Argent Microbiol. 2017; 49(2):125-31. DOI | PubMed
  10. Conceicao T, Santos Silva I, de Lencastre H, Aires-de-Sousa M. Staphylococcus aureus nasal carriage among patients and health care workers in Sao Tome and Principe. Microb Drug Resist. 2014; 20(1):57-66. DOI | PubMed
  11. Weterings V, Veenemans J, van Rijen M, Kluytmans J. Prevalence of nasal carriage of methicillin-resistant Staphylococcus aureus in patients at hospital admission in The Netherlands, 2010-2017: An observational study. Clin Microbiol Infect. 2019; 25(11):1428.e1-5. PubMed
  12. Dadashi M, Nasiri MJ, Fallah F, Owlia P, Hajikhani B, Emaneini M, et al. Methicillin-resistant Staphylococcus aureus (MRSA) in Iran: A systematic review and meta-analysis. J Glob Antimicrob Resist. 2018; 12:96-103. DOI | PubMed
  13. Kaur DC, Narayan PA. Mupirocin resistance in nasal carriage of Staphylococcus aureus among healthcare workers of a tertiary care rural hospital. Indian J Crit Care Med. 2014; 18(11):716-21. DOI | PubMed
  14. Shahsavan S, Emaneini M, Noorazar Khoshgnab B, Khoramian B, Asadollahi P, Aligholi M, et al. A high prevalence of mupirocin and macrolide resistance determinant among Staphylococcus aureus strains isolated from burnt patients. Burns. 2012; 38(3):378-82. DOI | PubMed
  15. Dadashi M, Hajikhani B, Darban-Sarokhalil D, van Belkum A, Goudarzi M. Mupirocin resistance in Staphylococcus aureus: A systematic review and meta-analysis. J Glob Antimicrob Resist. 2020; 20:238-47. DOI | PubMed
  16. Mahmoudi S, Mamishi S, Mohammadi M, Banar M, Ashtiani MTH, Mahzari M, et al. Phenotypic and genotypic determinants of mupirocin resistance among Staphylococcus aureus isolates recovered from clinical samples of children: An Iranian hospital-based study. Infect Drug Resist. 2019; 12:137-43. DOI | PubMed
  17. Kavitha E, Srikumar R. High-level mupirocin resistance in staphylococcus spp. among health care workers in a tertiary care hospital. Pharmacology. 2019; 103(5-6):320-3. DOI | PubMed
  18. Rashidi Nezhad R, Meybodi SM, Rezaee R, Goudarzi M, Fazeli M. Molecular characterization and resistance profile of methicillin resistant Staphylococcus aureus strains isolated from hospitalized patients in intensive care unit, Tehran-Iran. Jundishapur J Microbiol. 2017; 10(3):e41666. DOI
  19. Khandan del A, Ahani Azari A, Jamalli A, Ghaemi EA. Efficacy of mupirocin ointment in eradication of Staphylococcus aureus nasal carriage in intensive care unit staff and patients. Med Lab J. 2018; 12(3):12-6. DOI
  20. Humphries RM, Ambler J, Mitchell SL, Castanheira M, Dingle T, Hindler JA, et al. CLSI Methods development and standardization working group best practices for evaluation of antimicrobial susceptibility tests. J Clin Microbiol. 2018; 56(4):e01934-17. DOI | PubMed
  21. Taati Moghadam M, Hossieni Nave H, Mohebi S, Norouzi A. [The evaluation of connection between integrons class I and II and ESBL-producing and Non-ESBL klebsiella pneumonia isolated from clinical samples, Kerman (Persian)]. Iran J Med Microbiol. 2016; 10(4):1-9. https://ijmm.ir/browse.php?a_id=452&slc_lang=en&sid=1&ftxt=1
  22. Boroujeni MB, Mohebi S, Malekian A, Shahraeini SS, Gharagheizi Z, Shahkolahi S, et al. The therapeutic effect of engineered phage, derived protein and enzymes against superbug bacteria. Biotechnol Bioeng. 2024; 121(1):82-99. DOI | PubMed
  23. Akya A, Chegenelorestani R, Shahvaisi-Zadeh J, Bozorgomid A. Antimicrobial resistance of Staphylococcus aureus isolated from hospital wastewater in Kermanshah, Iran. Risk Manag Healthc Policy. 2020; 13:1035-42. DOI | PubMed
  24. Mir M, Kordi J, Ghalehnoo ZR, Tadjrobehkar O, Vaez H. Nasal carriage and antibiotic resistance pattern of methicillinresistant staphylococcus aureus isolates from clinical staff of a Referral Hospital, Zabol, Iran. Int J Basic Sci Med. 2019; 4(2):81-5. DOI
  25. Samadi R, Ghalavand Z, Mirnejad R, Nikmanesh B, Eslami G. Antimicrobial resistance and molecular characteristics of methicillin-resistant staphylococcus aureus isolates from children patients in Iran. Infect Drug Resist. 2019; 12:3849-57. DOI | PubMed
  26. Tabar MM, Mirkalantari S, Amoli RI. Detection of ctx-M gene in ESBL-producing E. coli strains isolated from urinary tract infection in Semnan, Iran. Electron Physician. 2016; 8(7):286-90. DOI | PubMed