Assessment of the Antimicrobial Resistance Spectrum and Identification of Extended-spectrum ß-lactamase (ESBL) in Acinetobacter Baumannii From Clinical Samples in Erbil City

Document Type : Original Articles

Authors

1 Department of Medical Microbiology, College of Science, International University of Erbil, Erbil, Iraq.

2 Department of Biology, College of Education, Salahaddin University-Erbil, Erbil, Iraq.

3 Department of Medical Laboratory Technology, Shaqlawa Technical College, Erbil Polytechnic University, Erbil, Iraq.

4 Department of Animal Resources, College of Agricultural Engineering Sciences, Salahaddin University-Erbil, Erbil, Iraq.

10.22092/ari.2024.366860.3300

Abstract

Introduction: Acinetobacter baumannii is a dangerous opportunistic pathogen responsible for a wide range of various infections, particularly in healthcare settings, affecting immunocompromised individuals. It is a significant source of nosocomial infections due to its ability to produce extended-spectrum β-lactamases (ESBLs) and carbapenemase enzymes, making it a major concern for antibiotic resistance. 
Materials & Methods: To investigate the significant occurrence of ESBL-producing A. baumannii in hospitalized individuals, a total of 250 clinical specimens were obtained cultured on blood agar and MacConkey agar media. Identification of isolates was conducted using both conventional microbiological techniques and the automated VITEK 2 system. Duplicate isolates and specimens from colonization-prone sites, including throat and perianal areaswere excluded. Antimicrobial susceptibility and ESBL production were evaluated according to Clinical and Laboratory Standards Institute (CLSI) standards.
Results: Out of 250 clinical specimens, 60(24%) out of 250 were culture-positive for A. baumannii infection. Thirty out of sixty isolates (50%) showed an A. baumannii infection that produced ESBL. 86.67% of the isolated bacteria exhibited multidrug resistance overall (52/60). Resistance profiling revealed that amikacin had the greatest resistance rate among the 60 isolates (100%), while tigecycline showed the lowest resistance rate among just 10 isolates (16.67%). Notably, colistin demonstrated complete efficacy, with a 0.00% resistance rate, making it the most effective antibiotic against A. baumannii in this study. The presence of ESBL genes were correlated with antibiotic resistance, particularly with cephalosporin medicines.
Conclusion: In conclusion, the present study highlights the prevalence of ESBL-producing A. baumannii strains, emphasizing the need for cautious antibiotic use and systematic monitoring of resistance mechanisms. The emergence of new ESBL strains necessitates continuous surveillance and further research on other ESBL-associated genes.

Keywords


1. Introduction

Acinetobacter baumannii is a gram-negative (G-), rod-shaped bacterium that typically appears as a small, nearly spherical coccobacillus. It causes blood, urinary tract, and lung infections (pneumonia), as well as sores in other areas of the body. In patients with open wounds or respiratory secretions (sputum), it may also “colonize” or remain there without producing illnesses or symptoms [ 1 ].

Recognized as an opportunistic pathogen, A. baumanni predominantly impacts individuals with compromised immune responses and is increasingly acknowledged as a significant nosocomial pathogen [ 2 ]. Unlike bacteria equipped with flagella, Acinetobacter species exhibit alternative motility mechanisms, such as twitching and swarming, likely facilitated by type IV pili—elongated structures capable of extension and retraction [ 3 ].

Infections caused by A. baumannii are more frequently observed in individuals with prolonged hospital stays, compromised immune systems, advanced age, underlying medical conditions, severe trauma or burns, prior antibiotic usage, or those requiring invasive procedures. Patients with indwelling medical devices, such as catheters or mechanical ventilators, are particularly at risk for such infections [ 4 ]. Finding an exact death rate for critically ill patients with A. baumannii infections is hard because their prognosis is already not good [ 5 ]. However, rough death rates have ranged from 23% to 68%. Currently, the cause of variations in clinical presentation between community-acquired and hospital-acquired infections, whether attributable to host or bacterial variables, remains unclear [ 6 ].

Hospitalized patients, especially those with prolonged hospital stays, prior exposure to broad-spectrum antibiotics or anticancer medications, are increasingly experiencing A. baumannii colonization. Spreading genes that are not sensitive to antibiotics have become a big problem in treating A. baumannii infections, leading to multiple drug resistance (MDR). Previous investigations have consistently demonstrated that A. baumannii displays resistance to a broad spectrum of antibiotics, encompassing fluoroquinolones, cephalosporins, carbapenems, tetracyclines, and aminoglycosides. The mechanisms of resistance entail both intrinsic and acquired approaches, including enzymatic inactivation, genetic mutations at the target sites, modifications in outer membrane permeability, and the excessive expression of efflux pumps. Notably, efflux pump systems contribute to MDR by enabling bacteria to expel antibiotics effectively [ 7 ]. This hospital-acquired disease is mostly resistant to antibiotics because of β-lactamases, changes to membrane porin channels, and mutations that change how cells work. The main way that bacteria become resistant is by making hydrolytic enzymes, attacking antibiotics, especially extended-spectrum β-lactamases (ESBLs) [ 8 ]. The predominant mechanism underpinning the resistance of A. baumannii to β-lactam antibiotics and various other antimicrobial agents in recent years has been elucidated as the production of ESBLs. These enzymes are responsible for conferring resistance to a broad range of antibiotics, including monobactams, cephalosporins, and penicillins. Hospitals worldwide are increasingly seeing MDR patterns brought on by pathogenic bacteria’s development of ESBLs. Because it results in treatment failures, longer hospital stays, and increased mortality rates, this is a public health issue [ 9 ].

More than 300 unique ESBL variants have been delineated among G- bacterial populations. Globally, the blaTEM and blaSHV genes have emerged as the predominant genetic determinants associated with ESBL production. In recent years, there has been a notable increase in the prevalence of the blaCTX-M gene family among clinical isolates. This gene family encompasses more than 130 β-lactamase variants, which are systematically classified into five distinct categories: blaCTX-M-1, blaCTX-M-2, blaCTX-M-8, blaCTX-M-9, and blaCTX-M-25 [ 10 ].

Recent trends across neighboring regions indicate a comparable rise in antibiotic resistance, especially among ESBL-producing bacteria. Researchers in Saudi Arabia have found that blaCTX-M, blaSHV, and blaTEM genes are commonly found in clinical isolates,indicating a regional pattern of resistance that poses a significant a public health concern [ 11 ]. Furthermore, a research conducted in Iran demonstrates a high prevalenceof ESBL-encoding genes in A. baumannii isolates [ 12 ]. In order to develop evidence-based strategies to address antibiotic resistance in clinical settings, it is essential to characterize the resistance genes encoding ESBL-producing A. baumannii [ 2 , 11 ].

1.1. Objectives

This study aims to investigate the antimicrobial resistance profiles of clinical strains and evaluate the prevalence of blaSHV, blaTEM, and blaCTX genes in A. baumannii isolates collected from various hospitals in Erbil city. The study underscores the critical role of ESBLs in antibiotic resistance and their implications for treatment failures.

2. Materials and Methods

2.1. Collection and identification of isolates

Patients were selected based on clinical indicators of infection, including symptoms such as fever, inflammation, and purulent discharge, alongside laboratory findings suggestive of bacterial infection. Samples were collected from patients across different departments, including intensive care units (ICUs), surgical wards, and outpatient clinics to capture a broad spectrum of A. baumannii infections. Between March 20, 2024, to June 19, 2024, a total of 250 infected samples were obtained from various clinical specimens: sputum (n=87), wound swab (n=64), stool (n=51), and burn (n=48). All samples were moved right away to the laboratory in an ice-packequipped cooler. Clinical samples were cultured on Blood and MacConkey agar (Merck, Germany) and incubated aerobically at 37 °C for 24 hours. To isolate pure colonies, non-lactose fermenting colonies on MacConkey agar, as well as non-hemolytic, creamy, and opaque colonies on blood agar, underwent further subculturing on MacConkey agar with an additional incubation period of 24 hours under the same conditions. Identification of A. baumannii isolates was performed through morphological examination of colonies and Gram staining. Verification of A. baumannii was achieved using the VITEK 2 system and standard biochemical tests, including oxidase, catalase, citrate utilization, urease activity, and indole production.

Further molecular confirmation was carried out using polymerase chain reaction (PCR) targeting the 16S rRNA gene. Amplification was performed using the Alpha PCRmax system (UK) with specific primers (forward: CACCTTCCGATACGGCTACC; reverse: GTTGACTGCCGGTGACAAAC). The PCR mixture consisted of 12.5 µL of master mix (AMPLIQON, Denmark), 1.0 µL of each primer, 1.5 µL of genomic DNA, and PCR-grade water to achieve a final volume of 25 µL. Amplification conditions included 40 cycles of denaturation at 95 °C for 30 seconds, annealing at 59 °C for 45 seconds, and extension at 72 °C for 60 seconds, with a final elongation at 72 °C for 10 minutes. The resulting amplicons were analyzed on a 1.2% agarose gel, revealing an expected size of 372 base pairs for the amplified 16S rRNA gene [ 13 ].

2.2. Antimicrobial susceptibility screening

In accordance with the guidelines established by the Clinical and Laboratory Standards Institute (CLSI) [ 14 ], antimicrobial susceptibility was assessed using the disk diffusion method. The antibiotic susceptibility tests involved a panel of antibiotics, including amikacin (AK, 30 µg), cefepime (CFP, 30 µg), ceftazidime (CAZ, 30 µg), ciprofloxacin (CIP, 5 µg), colistin (CST, 5 µg), gentamicin (G, 10 µg), imipenem (IMP, 30 µg), levofloxacin (LEV, 5 µg), meropenem (MEM, 10 µg), netilmicin (NET, 30 µg), piperacillin (PIP, 30 µg), tigecycline (TGC, 30 µg), and tobramycin (TOB, 10 µg), all procured from Bioanalyse, Turkey. Using a sterile brush, 100 μL of inoculum (1.5×108 CFU/mL) was evenly distributed across the whole surface of a Mueller Hinton Agar plate (Himedia, India), following the 0.5 McFarland standard to create a lawn of A. baumannii. Within fifteen minutes of inoculation, the disks were firmly placed on the surface of the agar plate [ 15 ].

2.3. Extraction of genomic DNA

Genomic DNA was extracted using the BETA BAYRN Genomic DNA Extraction Kit (BETA BAYRN, Germany), following the manufacturer’s guidelines. DNA was eluted with 50 µL of elution buffer and stored at -20 °C for subsequent PCR analysis. DNA concentration and purity were assessed using a NanoDrop 1000 spectrophotometer (ThermoFisher Scientific, USA).

2.4. Identification of ESBL-related genes through PCR analysis

Conventional multiplex PCR was employed to examine the molecular profile of genes associated with ESBLs (blaSHV, blaTEM, and blaCTX) in A. baumannii strains producing ESBLs. Primer sequences and their respective sizes are revealed in Table 1 [ 15 ].

Target Genes Primer Sequence (5'-3') Amplicon Size
blaTEM Forward TCG CCG CАТ АСА СТA TTC TCA GAA TGA 445-bp
Reverse ACG CTC ACC GGC TCC AGA TTT AT
blasHV Forward ATG CGT TATATT CGC CTG TG 747-bp
Reverse TGC TTT GTT ATT CGG GCC AA
blacrx Forward ATG TGC AGY ACC AGT AAR GTK ATG GC 593-bp
Reverse TGG GTR AAR TAR GTS ACC AGA AYC AGC GG
Table 1.List of primers used for multiplex PCR amplification

For detecting ESBL genes, PCR reactions were conductedin a 25 µL reaction volume containing 7 µL of PCR-grade water, 10 µL of master mix, 1 µL of primer mix, and 2 µL of genomic DNA. The cycling parameters included an initial denaturation at 95 °C for 10 minutes, followed by 40 cycles of denaturation at 95 °C for 30 seconds, annealing at 60 °C for 90 seconds, and extension at 72 °C for 120 seconds, with a final extension step at 72 °C for 10 minutes. PCR Amplicons were separated by electrophoresis on a 1.2% agarose gel containing Red Safe dye and visualized under UV light.

2.5. Data analysis

GraphPad Prism software, version 9.3 was employed for statistical analysis. Qualitative data were evaluated using the chi-square test. A P<0.05 was considered statistically significant for all analyses.

3. Results

3.1. Detection of A. baumannii isolates

The study analyzed 250 clinical samples comprising sputum (n=87), wound swabs (n=64), stool samples (n=51), and burn samples (n=48). Of these, 67 isolates (26.8%) were identified as A. baumannii using biochemical tests and the VITEK 2 system with GN cards. The isolates, collected at the Biotechnology Laboratory, Salahaddin University-Erbil, Iraq, were characterized as Gram-negative coccobacilli. They exhibited oxidase-negative, catalase-positive, urease-negative, citrate-negative, and indole-negative profiles. Verification of the 67 isolates through PCR confirmed the presence of the 16S rRNA gene (Figure 1). Among the isolates, 25(37.31%) were from females, and 42(62.69%) were from males, with a mean age of 51.43±0.8 years.

Figure 1.16S rRNA gene amplification via agarose gel electrophoresisNote: Lanes 1–12 show a positive amplicon for the 16S rRNA gene at 372 bps, lane M is a 50 bps DNA ladder, and lane NC is a negative control.

3.2. Detection of ESBL genes

Among the 67 A. baumannii isolates examined, 53(83.58%) contained the blaSHV gene, while 34(50.74%) harbored the blaCTX gene. The blaTEM gene was the most prevalent, detected in all analyzed isolates, as illustrated in Figure 2.

Figure 2. Multiplex PCR of ESBL genes (blaCTX, blaTEM, and blaSHV) using agarose gel electrophoresisNote: Lane M: 100 bps DNA ladder, lane NC: Negative control, lanes 1–12 with 445 bps blaTEM gene, lanes 3–12 with 593 bps blaCTX gene, and lanes 3, 4, 6, 7, 8, and 9 with 747 bps blaSHV gene.

3.3. Antimicrobial resistance

All isolates shown total resistance to AK. CST exhibited the greatest effectiveness against A. baumannii isolates, with all isolates showing sensitivity to CST. Sixtyone isolates (91.04%) exhibited resistance to CFP, CIP, IMP, and LEV, marking the greatest resistance rate after that of the AK antibiotic (Figure 3).

Figure 3. The heat map elucidates the levels of sensitivity (resistant, intermediate, and sensitive) of A. baumannii to several tested antimicrobial drugs

4. Discussion

4.1. Detection of ESBL genes

The results revealed a significant proportion of A. baumannii isolates producing ESBLs. Studies from Iran have reported alarming levels of drug and multidrug resistance in A. baumannii, including resistance to highly effective antibiotics such as IMP and MEM [ 16 ]. Ting et al. identified resistance genes—including blaTEM, blaSHV, blaCTX, blaDHA, blaCIT, blaIMP, blaVIM, blaKPC, and blaOXA-23—in seven IMP-resistant A. baumannii strains. The isolates exhibited the presence of blaTEM (100%) and blaOXA-23 (100%) genes. While, the other genes, including blaSHV, blaCTX, blaDHA, blaCIT, blaIMP, blaVIM, and blaKPC, were undetectable in seven strains of IMP-resistant A. baumannii.

In the current investigation, consistent with previous findings [ 17 ], many resistence genes were identified, including blaSHV (58%), blaTEM (20%), and blaVIM (30%). Shahcheraghi et al. conducted a research in Tehran, Iran, demonstrating that the MBL expressing genes identified among 203 A. baumannii isolates were blaVIM-2, blaSPM-1, blaIMP-2, blaGES-1, blaOXA-51, and blaOXA-23. Six isolates were discovered to generate MBLs, while 94 produced OXA-type carbapenemases. Their research suggests that the prevalence of MBL-producing A. baumannii strains in Tehran is lower than what was observed in the present study from Hamadan City. They detected blaSPM-1, blaGES-1, blaOXA-51, and blaOXA-23 genes in 6, 2, 94, and 84 bacterial isolates, respectively [ 18 ].

A previous investigation by Rezaee et al. identified genes encoding for 76 Acinetobacter species, including blaIMP, blaSPM-1, blaVIM, blaPER-1, blaVEB-1, bla-TEM, blaSHV, blaGES-1, and blaCTX-M. Moreover, they noted that 13.15% of their analyzed isolates carried the blaTEM-1 gene, which is similar to the 20% found in the current study, and 37% of isolates harbored at least one of the blaPER-1 or blaTEM-1 genes. Furthermore, none of the A. baumannii isolates they examined contained blaVEB-1, blaSHV, blaCTX-M2, or blaGES-1 [ 19 ].

A. baumannii is a bacterial pathogen known for causing nosocomial infections, primarily due to its high level of drug resistance [ 20 , 21 ]. Its ability to adhere to a variety of surfaces and medical devices significantly enhances its potential for colonization and transmission among hospitalized individuals [ 22 ]. This bacterium can withstand a wide range of existing drugs by acquiring resistance factors and enhancing innate resistance mechanisms [ 23 ]. A. baumannii exhibiting multidrug resistance causes severe infections and high fatality rates, especially in immunocompromised individuals [ 24 , 25 ]. According to our investigation, every isolate of A. baumannii showed resistance to a number of antibiotics. All isolates were sensitivity to CST and resistant to AK, aligning with results from previous Iranian investigations [ 26 , 27 ]. Zarifi et al. found that A. baumannii had significant resistance to all antibiotics except CST. The resistance rates for IMP, MEM, CAZ, cefotaxime, cefuroxime, ceftriaxone, CFP, ertapenem, and ampicillin/ sulbactam were 97.9%, 98.1%, 96.4%, 97.9%, 99.3%, 97.9%, 97.9%, 98.6%, and 97.1%, respectively. CST showed the highest efficacy as an antibiotic against A. baumannii, with a susceptibility rate of 97.9%, while AK exhibited a sensitivity of 27.1% [ 28 ].

Antibiotic resistance to monobactams, carbapenems, cephalosporins, and penicillin is mediatedby class A β-lactamases. These lactamases may have a restricted spectrum of activity or acquire an expanded range of antibiotic efficacy via point mutations. β-lactamase enzymes, particularly class A, contribute to resistance against antibiotics such as monobactams, cephalosporins, carbapenems, and penicillins. These enzymes are often inhibited by agents like clavulanic acid [ 1 ]. Additionally, the dissemination of ESBL genes among Gram-negative bacteria is facilitated by mobile genetic elements, such as plasmids [ 2 ]. Regular monitoring of bacterial strains that produce ESBLs, coupled with the detection of associated genes such as blaTEM-92, blaSHV, blaGES-11, blaGES-14, blaPER-1, blaPER-7, and blaVEB-1, is vital for effective clinical management. Additionally, other significant enzymes in this group include the cefotaxime-expanding β-lactamase (CTX-M) family and the Klebsiella pneumoniae carbapenemase (KPC) enzymes [ 3 ].

Therefore, resistance to third-generation cephalosporins is closely linked to the production of genotypic ESBLs. The epidemiological variety of ESBL-encoding genes in A. baumannii may indicate the continual emergence of novel ESBL strains. Upcoming research highlights the investigation of other ESBL-encoded genes. This research emphasized the need for more prudence in antibiotic use and the concerning rate of resistance.

As mentioned in the book, A. baumannii can acquire antibiotic resistance by altering the specific location where antibiotics are targeted, controlling the movement of medications across its cell membranes, and enzymatically changing antibiotics to render them ineffective. A. baumannii may augment antibiotic resistance not only via innate genetic pathways but also via other virulence-associated mechanisms. Mechanisms contributing to the resistance of A. baumannii include structural and functional adaptations, such as alterations in outer membrane proteins (e.g. porins) and components of the cell envelope (e.g. lipopolysaccharides and bacterial capsules). The development of resistance is further enhanced by various specialized mechanisms, including the action of enzymes such as phospholipases C and D, glycan-specific adamalysin-like protease CpaA, as well as processes like quorum sensing and biofilm production.

5. Conclusion

In conclusion, this study underscores the significant prevalence of ESBL-producing A. baumannii in clinical samples from Erbil City, contributing to high resistance rates against critical antibiotics. The presence of blaSHV, blaTEM, and blaCTX genes highlights the genetic basis for this resistance, with the blaTEM gene being most prevalent. The findings call for careful antibiotic stewardship and enhanced surveillance to track resistance patterns and emerging ESBL strains. Future research should explore additional ESBL-associated genes to develop comprehensive strategies for managing and mitigating antibiotic resistance in A. baumannii.

One limitation of this study was the lack of control strains in the antimicrobial susceptibility testing. Additionally, the findings are specific to clinical settings in Erbil City, which may limit their generalizability to other regions with different antimicrobial resistance patterns. Future research should aim to incorporate a broader range of control strains and expand the geographical scope to enhance the validity and applicability of the results. Additionally, given the increasing challenge posed by antibiotic-resistant bacteria, research into alternative treatment strategies, such as bacteriophage therapy, may offer promising solutions

Compliance with ethical guidelines

The research received ethical clearance from the Ethics Committee of International University of Erbil, Erbil, Iraq (Code: IUE-8). The study adhered to the ethical guidelines outlined by the committee, ensuring that all patient data were anonymized and handled with confidentiality. Informed consent was obtained from all participants or their legal guardians prior to sample collection. The current study was conducted in compliance with the Declaration of Helsinki and other local rules, emphasizing the reduction of possible hazards to participants while enhancing the scientific value of the research.

Data availability

The authors confirm that the data supporting the findings of this study are available within the article.

Funding

This research did not receive any grant from funding agencies in the public, commercial, or non-profit sectors.

Authors' contributions

Conceptualization and study design: Sayran Sabr Qadr and Pishtiwan Ahmed Hamad; Data acquisition: Sayran Sabr Qadr, Sozan Hamashrif Aziz, and Rebwar Muhammad Hamasalih; Writing the original draft: Mohsin Ali Ahmed and Pishtiwan Ahmed Hamad; Review and editing: Sayran Sabr Qadr, Mohsin Ali Ahmed, and Pishtiwan Ahmed Hamad.

Conflict of interest

The authors declared no conflict of interest.

References

  1. Lin MF, Lan CY. Antimicrobial resistance in Acinetobacter baumannii: From bench to bedside. World J Clin Cases. 2014; 2(12):787-814. DOI | PubMed
  2. Abdar MH, Taheri-Kalani M, Taheri K, Emadi B, Hasanzadeh A, Sedighi A, et al. Prevalence of extended-spectrum beta-lactamase genes in Acinetobacter baumannii strains isolated from nosocomial infections in Tehran, Iran. GMS Hyg Infect Control. 2019; 14:Doc02. DOI
  3. Abd El-Baky RM, Farhan SM, Ibrahim RA, Mahran KM, Hetta HF. Antimicrobial resistance pattern and molecular epidemiology of ESBL and MBL producing Acinetobacter baumannii isolated from hospitals in Minia, Egypt. Alex J Med. 2020; 56(1):4-13. DOI
  4. Wong D, Nielsen TB, Bonomo RA, Pantapalangkoor P, Luna B, Spellberg B. Clinical and pathophysiological overview of acinetobacter infections: A Century of Challenges. Clin Mi-crobiol Rev. 2017; 30(1):409-47. DOI | PubMed
  5. Freire MP, de Oliveira Garcia D, Garcia CP, Campagnari Bueno MF, Camargo CH, Kono Magri ASG, et al. Bloodstream infection caused by extensively drug-resistant Acinetobacter baumannii in cancer patients: high mortality associated with delayed treatment rather than with the degree of neutropenia. Clin Microbiol Infect. 2016; 22(4):352-8. DOI | PubMed
  6. Morris FC, Dexter C, Kostoulias X, Uddin MI, Peleg AY. The Mechanisms of Disease Caused by Acinetobacter baumannii. Front Microbiol. 2019; 10:1601. DOI | PubMed
  7. Moosavian M, Ahmadi K, Shoja S, Mardaneh J, Shahi F, Afzali M. Antimicrobial resistance patterns and their encod-ing genes among clinical isolates of Acinetobacter baumannii in Ahvaz, Southwest Iran. MethodsX. 2020; 7:101031. DOI | PubMed
  8. Khoshnood S, Heidary M, Mirnejad R, Bahramian A, Sedighi M, Mirzaei H. Drug-resistant gram-negative uropath-ogens: A review. Biomed Pharmacother. 2017; 94:982-94. DOI | PubMed
  9. Jiang W, Yang W, Zhao X, Wang N, Ren H. Klebsiella pneumoniae presents antimicrobial drug resistance for β-lactam through the ESBL/PBP signaling pathway. Exp Ther Med. 2020; 19(4):2449-56. DOI
  10. Dirar MH, Bilal NE, Ibrahim ME, Hamid ME. Prevalence of extended-spectrum β-lactamase (ESBL) and molecular detection of blaTEM, blaSHV and blaCTX-M genotypes among Enterobacteriaceae isolates from patients in Khartoum, Sudan. Pan Afr Med J. 2020; 37:213. DOI | PubMed
  11. Ibrahim ME, Algak TB, Abbas M, Elamin BK. Emergence of bla (TEM), bla (CTX-M), bla (SHV) and bla (OXA) genes in multidrug-resistant Enterobacteriaceae and Acinetobacter baumannii in Saudi Arabia. Exp Ther Med. 2021; 22(6):1450. DOI | PubMed
  12. Azizi M, Mortazavi SH, Etemadimajed M, Gheini S, Vaziri S, Alvandi A, et al. Prevalence of Extended-Spectrum β-Lactamases and Antibiotic Resistance Patterns in Acinetobacter baumannii Isolated from Clinical Samples in Kermanshah, Iran. Jundishapur J Microbiol. 2017; 10(12):e61522. DOI
  13. Hamasalih R, Abdulrahman Z. Antibiofilm potency of ginger (Zingiber officinale) and quercetin against Staphylococcus aureus isolated from urinary tract catheterized patients. Appl Ecol Environ Res. 2020; 18(1):219-36. DOI
  14. Humphries R, Bobenchik AM, Hindler JA, Schuetz AN. Overview of changes to the clinical and laboratory standards institute performance standards for antimicrobial susceptibility testing, M100, 31st Edition. J Clin Microbiol. 2021; 59(12):e0021321. DOI | PubMed
  15. Bakr KI, Abdul-Rahman SM, Muhammad Hamasalih R. Molecular detection of β-lactamase genes in Klebsiella pneumoniae and Escherichia coli isolated from different clinical sources. Cell Mol Biol (Noisy-le-grand). 2022; 67(4):170-80. DOI | PubMed
  16. Feizabadi MM, Fathollahzadeh B, Taherikalani M, Ra-soolinejad M, Sadeghifard N, Aligholi M, et al. Antimicrobial susceptibility patterns and distribution of blaOXA genes among Acinetobacter spp. Isolated from patients at Tehran hospitals. Jpn J Infect Dis. 2008; 61(4):274-8. DOI | PubMed
  17. Ting C, Jun A, Shun Z. Detection of the common resistance genes in Gram-negative bacteria using gene chip technology. Indian J Med Microbiol. 2013; 31(2):142-7. DOI | PubMed
  18. Shahcheraghi F, Abbasalipour M, Feizabadi M, Ebrahimi-pour G, Akbari N. Isolation and genetic characterization of metallo-β-lactamase and carbapenamase producing strains of Acinetobacter baumannii from patients at Tehran hospitals. Iran J Microbiol. 2011; 3(2):68-74. PubMed
  19. Rezaee MA, Pajand O, Nahaei MR, Mahdian R, Aghaza-deh M, Ghojazadeh M, et al. Prevalence of Ambler class A β-lactamases and ampC expression in cephalosporin-resistant isolates of Acinetobacter baumannii. Diagn Microbiol Infect Dis. 2013; 76(3):330-4. DOI | PubMed
  20. Jahangiri S, Malekzadegan Y, Motamedifar M, Hadi N. Virulence genes profile and biofilm formation ability of Acinetobacter baumannii strains isolated from inpatients of a tertiary care hospital in southwest of Iran. Gene Rep. 2019; 17:100481. DOI
  21. Nowak P, Paluchowska PM, Budak A. Co-occurrence of carbapenem and aminoglycoside resistance genes among multidrug-resistant clinical isolates of Acinetobacter baumannii from Cracow, Poland. Med Sci Monit Basic Res. 2014; 20:9-14. DOI | PubMed
  22. Choi WS, Kim SH, Jeon EG, Son MH, Yoon YK, Kim JY, et al. Nosocomial outbreak of carbapenem-resistant Acinetobacter baumannii in intensive care units and successful outbreak control program. J Korean Med Sci. 2010; 25(7):999-1004. DOI | PubMed
  23. Zeighami H, Valadkhani F, Shapouri R, Samadi E, Haghi F. Virulence characteristics of multidrug resistant biofilm form-ing Acinetobacter baumannii isolated from intensive care unit patients. BMC Infect Dis. 2019; 19(1):629. DOI | PubMed
  24. Howard A, O’Donoghue M, Feeney A, Sleator RD. Aci-netobacter baumannii: An emerging opportunistic patho-gen. Virulence. 2012; 3(3):243-50. DOI | PubMed
  25. Poirel L, Bonnin RA, Nordmann P. Genetic basis of anti-biotic resistance in pathogenic Acinetobacter species. IUBMB Life. 2011; 63(12):1061-7. DOI | PubMed
  26. Vahdani P, Yaghoubi T, Aminzadeh Z. Hospital acquired antibiotic-resistant acinetobacter baumannii infections in a 400-bed hospital in Tehran, Iran. Int J Prev Med. 2011; 2(3):127-30. PubMed
  27. Saffari F, Monsen T, Karmostaji A, Azimabad FB, Wider-ström M. Significant spread of extensively drug-resistant Aci-netobacter baumannii genotypes of clonal complex 92 among intensive care unit patients in a university hospital in south-ern Iran. J Med Microbiol. 2017; 66(11):1656-62. DOI | PubMed
  28. Zarifi H, Eslami G, Khaledi A, Vakili M, Vazini H. Preva-lence of ESBLs in Acinetobacter baumannii isolated from intensive care unit (ICU) of Ghaem hospital, Mashhad, Iran. J Pure Appl Microbiol. 2017; 11(2):811-9. DOI