Toxic genes and antibiotic resistance patterns in Vibrio Parahaemolyticus isolates from caught fish of the Caspian Sea

1.Introduction

The presence of pathogenic bacteria in marine environments poses concerns regarding the food safety due to their potential to cause foodborne diseases. Vibrio parahaemolyticus (V. parahaemolyticus) belongs to the Vibrionaceae family. It is a halophilic, gram-negative bacterium with a rod-shaped morphology and is capable of motility and surviving and reproducing in environments with a sodium chloride (NaCl) concentration ranging from 1 to 9%. This bacterium naturally inhabits aquatic environment such as marine, estuarine and coastal environments and is commonly associated with various types of seafood, including fish, shrimp, lobster, and shellfish ( 2 , 3 ).

The toxR gene, thermostable direct hemolysin (tdh) and tdh-related hemolysin (TRH) are some of the known virulence genes involved in Vibrio pathogenesis. Infections caused by V. parahaemolyticus occur due to the presence of different virulence factors including adhesins (Type I pilus), type III secretion systems (T3SS), and type VI secretion systems (T6SS). The toxR gene acts as a gene for tdh and trh. The tdh gene encodes a pore-forming protein that facilitates bacterial invasion in humans, while trh plays a similar role to tdh in causing disease ( 4 , 5 ). The presence of toxR, tdh, and trh genes helps differentiate potentially virulent strains of V. parahaemolyticus from non-virulent strains. The virulence genes associated with V. parahaemolyticus, particularly those involved in hemolysis and cytotoxicity, cause acute gastroenteritis in the host, with symptoms such as watery diarrhea, abdominal cramps, nausea, vomiting, fever, headache, and/or bloody diarrhea in humans who consume raw, undercooked, or mishandled seafood contaminated with V. parahaemolyticus ( 6 ).

Additionally, contact with open wounds and V. parahaemolyticus can also lead to wound infections, and in rare cases life-threatening septicemia, particularly in individuals with underlying medical conditions. V. parahaemolyticus is responsible for numerous seafood-related food poisoning cases in many Asian countries including Japan, Taiwan and India ( 7 , 8 ). In the United States, approximately 80% of the estimated 5.2 million cases of bacterial diarrhea cases are linked to foodborne illnesses ( 9 ). Given the global prevalence of V. parahaemolyticus gastroenteritis cases, it is crucial to investigate the prevalence of these bacteria, their virulence genes, and their impact on humans.

According to the Centers for Disease Control and Prevention report (CDC), V. parahaemolyticus was identified as the most common foodborne pathogen, accounting for 39–51% of Vibrio infections compared to other Vibrio species such as V. vulnificus, V. cholerae (non-O1 and non-O139), V. alginolyticus, V.fluvialis, V. mimicus, and V. hollisae ( 10 ).

In recent years, the emergence of antibiotic-resistant infections has become a global health concern. Therefore, timely surveillance of antibiotic-resistant bacteria and the dissemination of surveillance data are essential to address these public health issues. A significant number of V. parahaemolyticus strains isolated from clinical and environmental samples have shown high resistance to multiple antibiotics such as amoxicillin, ampicillin, ceftazidime, and gentamicin ( 11 , 12 ). The extensive use and misuse of antibiotics for the treatment of seafood-related diseases are likely the main contributors to the rise of multiple drug resistance (MDR) in V. parahaemolyticus isolates ( 13 , 14 ). This study aims to assess the prevalence, toxin-producing genes and antimicrobial resistance patterns in V. parahaemolyticus isolates from Caspian Sea fish.

2. Materials and Methods

2.1 Sample Collection and Isolation of V. Parahaemolyticus

In a descriptive cross-sectional study, a total of 220 fish samples were collected from the Caspian Sea between August 2022 and August 2023. The samples consisted of four species : Rutilus kutum, Mugilidae, Cyprinus carpio and Perca. To preserve sample integrity, they were placed in sealed containers with dry ice and transported frozen to the laboratory within approximately 24 hours. Isolation of V. parahaemolyticus bacteria was carried out following standard protocols established by the US Food and Drug Administration (FDA). The protocols were summarized as follows:

A 5-gram portion of each sample was enriched in 45 mL of alkaline peptone water containing 3% NaCl for 24 hours. A loopful of the enriched mixture was then cultured on thiosulphate citrate bile salt sucrose (TCBS) agar (Merck, Germany). After incubation at 37°C for 24 hours, the green colonies were selected and subjected to Gram staining, oxidase activity assessment, ONPG, Triple-Sugar-Iron (TSI), Urease, Citrate, Lysin, and Arginine tests ( 15 , 16 ).

2.2. Antimicrobial Susceptibility Testing (AST)

Antimicrobial susceptibility of the V. parahaemolyticus isolates was determined using the disk diffusion method, in accordance with Clinical and Laboratory Standards Institute (CLSI) guidelines ( 17 ).

The susceptibility tests were performed using Nutrient Agar, Muller-Hinton agar, and a panel of 10 antibiotic disks (Mast, UK) was used for antibiotic susceptibility tests, including ampicillin (10 μg), ceftazidime (30 μg), chloramphenicol (30 μg), ciprofloxacin (5 μg), gentamicin (10 μg), meropenem (10 μg), trimethoprim-sulfamethoxazole (25 μg), tetracycline (30 μg), amoxicillin (25 μg), and doxycycline (30 μg). P. aeruginosa ATCC 27853 and V. parahaemolyticus ATCC 17802 were used as quality control organisms.

2.3 DNA Extraction

Genomic DNA was extracted as described by the boiling method ( 12 ). Fresh colonies of the V. parahaemolyticus isolates were suspended in 400 μL of sterile deionized water and mixed using a vortex mixer well. The mixture was heated at 100°C for 15 minutes on a thermo block device. After heating, the samples were centrifuged at 11000 rpm for 10 minutes. The supernatants containing genomic DNAwere transferred to microtubes and stored at -20°C until further molecular analysis. The concentration of the extracted DNA was measured using a Nanodrop (Nano Drop^TM One Microvolume UV-Vis Spectrophotometers).

2.4 PCR Confirmation (Detection of Virulence Genes: tox R, tdh, and trh)

PCR was performed to detect the presence of 16S rRNA, toxR, tdh, and trh genes in the V. parahaemolyticus isolates ( 4 ). The primer sequences used for the genes were as follows ( 18 , 19 ).:

rRNA-F: GCAGCTGATCAAAACGTTGAGT, rRNA-R:ATTATCGATCGTGCCACTCAC.

toxR-F:GTCTTCTGACGCAATCGTTG, toxR-R:ATACGAGTGGTTGCTGTCATG, tdhF:GTAAAGGTCTCTGACTTTTGGA, tdh-R:TGGAATAGAACCTTCATCTTCACC, trh-F: TTGGCTTCGATATTTTCAGTATCT, trh-R: CATAACAAACATATGCCCATTTCCG

PCR reactions were prepared in a total volume of 20 μL, consisting of 10 μL of Mastermix, 1.5 μL of DNA, 1 μL of primers and 7.5 μL of distilled water (D.W.).

The PCR reaction was performed using an amplification thermal cycler (Q lab, peckstar). The reaction consisted of pre-denaturation at 95°C for 5 minutes; followed by 30 cycles of the main thermal program (denaturation at 95°C for 45 seconds, annealing at 59°C for 50 seconds, extension at 72°C for 45 seconds), and a final extension at 72°C for 5 minutes. The amplified PCR products were then subjected to gel electrophoresis (Bio-Rad), and the gel image was recorded using a Gel Doc device. Positive controls included V. parahaemolyticus strains ATCC33847 (toxR+, tdh+) and ATCC17802 (toxR+, trh+), while sterile distilled water served as the negative control.

3. Results

3.1 Prevalence of V. Parahaemolyticus and Virulence Genes

Out of the 220 fish samples examined, 40 samples (18.2%) were found to be contaminated with V. parahaemolyticus (Table 1). Molecular testing confirmed the presence of V. parahaemolyticus, as illustrated in Figure 1. All 40 isolates of V parahaemolyticus, which were confirmed through biochemical testing, possessed the 16S rRNA gene.

Figure 1. The presence of V. parahaemolyticus by PCR amplification of 16S rRNA gene. M Ladder: 100 bp; P: Positive control; N: Negative control; Numbers 1 to 4: Isolates containing 16S rRNA gene.

PCR assay demonstrated that the toxR gene was detected in all 40 (100%) of the confirmed isolates. The presence of the thermostable direct hemolysin (tdh) gene was observed in 29 (72.5%) of the isolates. Notably, none of the V. parahaemolyticus isolates exhibited tdh-related hemolysin (trh) gene. The findings from agarose gel electrophoresis, employed for PCR amplification, are presented in Figure 2.

Figure 2. The presence of V. parahaemolyticus by detection of virulence factor genes. M: Ladder 50 bp; P: Positive control; N: Negative control. A, Numbers 1-4: Isolates of V. parahaemolyticus containing toxR gene (368 bp). B, Lines 1-4: Isolates of V. parahaemolyticus containing tdh gene (269 bp). C, Line 1-4: Isolates of V. parahaemolyticus containing trh gene (500 bp).

3.2 Antimicrobial susceptibility of the V. parahaemolyticus isolates

The antibiotic resistance profile of the V. parahaemolyticus isolates were assessed. The findings revealed high susceptibility to ciprofloxacin (97.5%), chloramphenicol (92.5%), and gentamycin (87.5%). However, resistance was noted for amoxicillin (95%), doxycycline (95%) and tetracycline (92.5%). Detailed results regarding antimicrobial resistance can be found in Table 2.

4. Discussion

The widespread consumption of fish among Iranian households, combined with the significant contribution of Caspian Sea fisheries, underscores the public health ( 20 ).

Consequently, this study on the prevalence of V. parahaemolyticus holds considerable importance in the promotion of public health.

The detection of Vibrio parahaemolyticus in 18.1% of fish samples highlights the bacterium’s prevalence in the region, likely due to its ability to tolerate high-salinity environments. These findings confirm the dominance of V.parahaemolyticus as the predominant microbial flora in the Caspian Sea. The majority of V. parahaemolyticus strains isolated from fish samples carried the toxR and tdh virulence genes, with rates of 100% and 72.5%, respectively, while the trh gene was absent. The absence of the trh gene is noteworthy, as it is associated with gastroenteritis resulting from the consumption of raw or undercooked fish and other related products.

Our results are in line with previous studies conducted nationally and internationally. For instance, Najafi (2006) and Jalali (2010) reported lower frequencies of V. parahaemolyticus in farmed and marine fish (5-10% and 3.9%, respectively) ( 14 , 15 ), suggesting a lower level of V. parahaemolyticus contamination in farmed fish and processed fish that have undergone proper cold storage procedures. Alipour et al, conducted a study on water and sediment samples from the Caspian Sea, revealing that 98 out of samples (20.3%) tested positive for V. parahaemolyticus, indicating a relatively high presence of the bacterium in the waters of the Caspian Sea and subsequent contamination of most fish and animals ( 16 ).

Rahimi et al. conducted a study on 132 shrimp and crab samples, while Raisi et al. examined 300 shrimp from the Persian Gulf.

They observed contamination rates of 3.03% and 9.5% with V. parahaemolyticus, respectively ( 18 , 21 ). Another study by Safarpour et al. reported a presence of 22% V. parahaemolyticus in fish from the Persian Gulf, which is higher compared to previous similar studies. The majority of V. parahaemolyticus strains isolated from fish and lobster samples carried the tdh (23.45%) and trh (66.16%) virulence genes, confirming their high pathogenicity ( 19 ).

Zarei et al., studied the infection rates of V. parahaemolyticus in shrimp caught during different seasons. Their findings showed infection rates of 19% in summer, 13% in spring, 8% in autumn, and 4% in winter. The higher prevalence of V. parahaemolyticus in summer samples can be attributed to increased salt concentration in the water resulting from evaporation caused by heat, creating favorable conditions for bacterial growth and spread.

Additionally, 0.6% of the V. parahaemolyticus strains isolated from these samples carried the toxR virulence gene ( 22 ).

In a study conducted in Zanjan, Iran, shrimp samples were examined and found to have a 17.1% positive rate for V. parahaemolyticus among the 70 samples tested. Among the V. parahemolyticus positive samples, the tdh and trh genes were present in 2.8% and 1.4% of samples, respectively ( 23 ). Numerous studies conducted in European countries and East Asia have shown the prevalence of Vibrio species, particularly V. parahaemolyticus, along the coasts of Asia and East Asia ( 24 , 25 , 26 ).

Therefore, proper cooking of marine products is crucial in these countries to prevent gastroenteritis caused by V. parahaemolyticus.

In line with the aforementioned findings, Ottiviani et al. discovered that 11.6% of 559 oyster samples caught in the Adriatic Sea were infected with V. parahaemolyticus, with 7.7% of these strains carrying the trh gene, which contributes to hemolysis of red blood cells and weaken the immune system ( 24 ). This report indicates that V. parahaemolyticus poses a higher pathogenic potential due to its virulence genes when consuming contaminated raw or uncooked products. Thus, the presence of these virulence genes in V. parahaemolyticus contributes significantly to its pathogenicity.

The finding of Letchumanan et al. in Malaysia and Kang et al. on the coast of Korea indicated a high prevalence of V. parahaemolyticus species in seafood, with rates of 100% and 37.6%, respectively ( 25 , 26 ). Similarly, Yang et al. conducted a study on 504 samples of shrimp, fish, and oysters from the southern coast of China and found that 64% of the samples were infected with V. parahaemolyticus. Among these samples, 8.1% and 12.2% of the strains were positive for the tdh and trh genes ( 27 ), indicating toxigenic potential. Mahmud et al., isolated 192 strains of V. parahaemolyticus from seawater and seaweeds in the K channel in Japan, and 18 samples (9.3%) carried toxic or toxigenic genes ( 28 ).

Haque et al., and Xiaoke et al., in studies conducted on fish, oysters, and shrimp in Bangladesh and China, respectively, reported frequencies of 95% and 37.7% for V. parahemolyticus ( 29 , 30 ). Although the results of these studies were higher than our current study, none of the V. parahaemolyticus isolates in our study was positive for the tdh or trh genes.

Additionally, Kshirsagar et al., in a study on fish and shrimp samples in Gujarat, India, reported an infection rate of 11.61% for V. parahaemolyticus species. The tdh gene was found in 11.11% of the samples, but the trh gene was absent in all isolates, consistent with our findings ( 31 ).

The occurrence rates of contamination by various Vibrio species in marine products exhibit regional variation within Iran. This variation can be attributed to multiple factors, such as sample types, collection seasons, ecological circumstances, environmental pollution, species discrepancies, and substantial disparities in sanitary conditions from the point of fish capture to its delivery. It is noteworthy to mention that, in addition to the primary contamination stemming from fish caught in the Caspian Sea, secondary contamination can also contribute to the heightened prevalence of V. parahaemolyticus in fish. The lack of proper hygiene standards in fishing and processing platforms, as well as in centers for selling and distributing marine products likely plays a very significant role. Contact between the caught marine products and contaminated surfaces are likely one of the key factors leading to secondary contamination. Additionally, inadequate cooling processes for these products can further contribute to contamination.

Diversity in resistance patterns emphasizes the need for regional surveillance and tailored antibiotic strategies. The presence of multidrug-resistant V. parahaemolyticus in seafood poses a serious public health risk, especially when consumed raw or undercooked.

Our study found that the isolated V. parahaemolyticus strains demonstrated the highest resistance pattern to amoxicillin (95%) and doxycycline (95%). Other studies conducted in Iran showed that this bacterium is sensitive to chloramphenicol and cephalothin and resistant to streptomycin, ampicillin, and nalidixic acid ( 14 ). These findings are consistent with global studies of sensitivity to chloramphenicol and ciprofloxacin, and resistance to streptomycin, nalidixic acid, and ampicillin ( 26 , 27 ).

The variations in antibiotic resistance patterns and the unique spectrum of resistance highlight the presence of diverse antibiotic patterns among different strains of V. parahaemolyticus in different regions. This underscores the significance of this species in fish contamination and the subsequent development of gastroenteritis from consuming contaminated seafood. The findings of this study underscore the relatively high microbial contamination with V. parahaemolyticus in fish samples caught from the Caspian Sea. Consequently, consuming these marine products, either raw or partially cooked, can pose a problem. Therefore, it is crucial to determine the antibiotic resistance pattern in these isolates to identify the most effective antibiotic and treatment approach.

In conclusion, this study provides valuable and critical information regarding the microbial contamination of fish caught from the Caspian Sea. The high prevalence of V. parahaemolyticus in seafood, along with the identification of multidrug-resistant isolates, presents a potential risk to human health. Therefore, appropriate control measures should be implemented to minimize the risk of contamination. Consuming raw or undercooked fish can result in gastrointestinal issues such as heart problem, diarrhea, and gastroenteritis.

This research highlights the importance of adequately cooking marine products as the principal preventive measure against vibriosis caused by V. parahaemolyticus. Implementing effective health monitoring practices in fishing and distribution centers for marine products can help reduce pollution levels in these products. Furthermore, providing up-to-date information on antibiotic-resistant V. parahaemolyticus strains is crucial for ensuring the effective treatment of human and aquatic product infections.

Acknowledgment

We would like to extend our gratitude to the Vice Chancellor for Research of Tehran University of Medical Sciences for sponsoring this research project (Grant46019). This article is the result of a research grant approved by the Zoonoses Research Center, Tehran University of Medical Sciences.

Authors' Contribution

Study concept and design: MMSD.

Acquisition of data: MMSD, ZR, EY.

Analysis and interpretation of data: MMSD, EY.

Drafting of the manuscript: ZR, EY.

Critical revision of the manuscript for important intellectual content: MMSD, EY.

Statistical analysis: HM.

Administrative, technical, and material support: HM.

Ethics

This research was approved by the Ethics Committee of Tehran University of Medical Sciences under the code IR.TUMS.VCR.REC.1398.1069.

Conflict of Interest

The authors declare no competing interests.

Data Availability

The data that support the findings of this study are available on request from the corresponding author.

References

1. Namadi P, Deng Zh. Optimum environmental conditions controlling prevalence of vibrio parahaemolyticus in marine environment. Marine Env Res. 2023; 183:105828.
2. Waidner L, Potdukhe T. Tools to Enumerate and Predict Distribution Patterns of Environmental Vibrio vulnificus and Vibrio parahaemolyticus. Microorganisms. 2023; 11(10):2502.
3. Masoumi H, Gouya M, Soltan-Dallal MM, Aghili N. Surveillance for foodborne disease outbreaks in Iran, 2006-2011. Med J Islam Rep Iran. 2015; 29
4. Kim YB, Okuda J, Matsumoto C, Takahashi N, Nishibuchi M. Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxR gene. J Clin Microbiol. 1999; 37(4):1173-7.
5. Newton AE, Garrett N, Stroika SG, Halpin JL, Turnsek M, Rajal K M, Centers for Disease Control and Prevention (CDC). Increase in Vibrio parahaemolyticus infections associated with consumption of Atlantic Coast shellfish—2013. MMWR. 2014; 63(15):335-6.
6. Haibo Zh, Xinmei L, Zhaoxin L, Antuo H, Wenjie M, Changzheng S, et al. Quantitative detection of Vibrio parahaemolyticus in aquatic products by duplex droplet digital PCR combined with propidium monoazide. Food Control. 2023; 144:109353.
7. Kunbawui P, S M , AR, Ji YK, Tae H, B S.   Occurrence and virulence of Vibrio parahaemolyticus isolated from seawater and bivalve shellfish of the Gyeongnam coast, Korea, in 2004–2016. Marine Pollut Bullet. 2018; 137:382-387.
8. Yutaka Y, Kaoru H, Masataka S, Isao T, Masatoshi B, Dusit A. Prevalence and antimicrobial susceptibility of Vibrio species related to food safety isolated from shrimp cultured at inland ponds in Thailand. Food control. 2014; 38 (1):30-6.
9. Soltan Dallal MM , Motalebi S, Masoumi H, Sharifi Y MK, Rahimi forushani A. Antimicrobial investigation on the multi-state outbreak of salmonellosis and shigellosis in Iran. Med J Islam Rep Iran. 2020; 34:49.
10. Heba A A, M E B, A H, H E K, M A R, M M E. Molecular characterization, antibiotic resistance pattern and biofilm formation of Vibrio parahaemolyticus and V. cholerae isolated from crustaceans and humans. Int J Food Microbiol. 2018; 274:31-37.
11. Chia W T, Yaya R, Hanan H, Tze Y T, Epeng L, Wendy D R, et al. Prevalence and antibiotic resistance patterns of Vibrio parahaemolyticus isolated from different types of seafood in Selangor, Malaysia. Saudi J Biol Sci.  2020; 27(6):1602-08.
12. Reshma S, Deborah A, Mohamed A.  Prevalence, antibiotic resistance, virulence and plasmid profiles of Vibrio parahaemolyticus from a tropical estuary and adjoining traditional prawn farm along the southwest coast of India. Ann Microbiol. 2015; 65(4):2141-49.
13. Hyo-Won J, Jin-Ah K, Su-Jin J, Seong-Seon C, Min-Kyeong K, Hye-Jin Y, et al. Prevalence, antibiotic-resistance, and virulence characteristics of Vibrio parahaemolyticus in restaurant fish tanks in seoul, South Korea. Foodborne Pathog Dis. 2020; 17(3):209-14.
14. Najafi A, Sadeghifar NKH, Bagheri T Y, Salari MH, Shirazi MH, Ranjbar R. Isolation of Vibrio paraheamoliticus from fish in Tehran and their antimicrobial resistance.  Iran J Infect Dis Trop Med. 2006; 11(35): 65-8.
15. Jalali M MM, Mahdavi M, Javadi A, Khorvash F. Prevalence of Vibrio parahaemolyticus in seefoods in isfahan. Iran J Infect Dis Trop Med. 2010; 14(46):33-6.
16. Alipour M, Issazadeh K, Soleimani J. Isolation and identification of Vibrio parahaemolyticus from seawater and sediment samples in the southern coast of the Caspian Sea. Comp Clin Path. 2012; 23(1):129-33.
17. Hindler J, Humphries R, Richter S, Jorgensen J, Bernard K, Killian S, et al. Methods for antimicrobial dilution and disk susceptibility testing of infrequently isolated or fastidious bacteria. M45, 3rd edn.
18. Rahimi E, Ameri M, Doosti A, Gholampour AR. Occurrence of toxigenic Vibrio parahaemolyticus strains in shrimp in Iran. Foodborne Pathog Dis. 2010; 7(9):1107-1111. DOI
19. Safarpourdehkordi F, Hosseini S, Rahimi E, Momeni M, Yahaghi E, Khodaverdi E. Investigate the frequency of virulence genes Vibrio parahaemolyticus isolated from fish, lobsters and crabs caught from Persian Gulf. Iran J Med Microbiol. 2018; 8(2):1-7.
20. Hashempour-Baltork F, Jannet B, Tajdar-Oranj B, Aminzare M, Sahebi H, Alizadeh A, et al.  A comprehensive systematic review and health risk assessment of potentially toxic element intakes via fish consumption in Iran. Ecotoxicol Env Safety.  2023; 249:114349.
21. Raissy M, Moumeni M, Ansari M, Rahimi E. Antibiotic resistance pattern of some Vibrio strains isolated from seafood. Iran J Fisheries Sci. 2012; 11(3):618-26.
22. Zarei M, Pourmahdi B M, Jamnejad A, Khezrzadeh M. Seasonal prevalence of Vibrio species in retail shrimps with an emphasis on Vibrio parahaemolyticus. Food Control. 2012; 25(1):107-9.
23. Asgarpoor D, Haghi F, Zeighami H. Detection and Molecular Characterization of Vibrio Parahaemolyticus in Shrimp samples. Open Biotech J. 2018; 12: 46-50.
24. Ottaviani D, Santarelli S, Bacchiocchi S, Masini L, Ghittino C, Bacchiocchi I. Presence of pathogenic Vibrio parahaemolyticus strains in mussels from the Adriatic Sea, Italy. Food microbiol. 2005; 22(6):585-90.
25. Vengadesh L, Wai-Fong Y, Learn-Han L, Kok-Gan C.   Prevalence and antimicrobial susceptibility of Vibrio parahaemolyticu s isolated from retail shrimps in Malaysia. Front Microbiol. 2015; 6:33.
26. Chang-Ho K, YuJin S, WooRi K, YongGyeong K, KiCheol S, Eun-Gyoung O, et al. Prevalence and antimicrobial susceptibility of Vibrio parahaemolyticus isolated from oysters in Korea. Env Sci Pollut Res. 2016; 23 (1):918-26.
27. Ying Y, Jiafang X, Hua L, Shuwen T, Yanfeng C, Hui Y.  Prevalence, antibiotic susceptibility and diversity of Vibrio parahaemolyticus isolates in seafood from South China. Front Microbiol. 2017; 8:2566.
28. Zahid H M, Afework K, Alizadeh M, Masayuki Y, Bhuiyan N, Balakrish N. Isolation and molecular characterization of toxigenic Vibrio parahaemolyticus from the Kii Channel, Japan. Microbiol Res. 2006; 161(1):25-37.
29. Manirul H, Anwar H, Shankar C M, Mohammad R, Zahid M. Prevalence, characterization and antibiotic susceptibility of Vibrio parahaemolyticus isolated from fishes and shellfishes of coastal regions of Bangladesh. Dhaka Uni J Biol Sci. 2015; 24(2):121-9.
30. Xiaoke Xu, Qingping Wu, Jumei Zhang, Jianheng Cheng, Shuhong Zhang, Kui Wu. Prevalence, pathogenicity, and serotypes of Vibrio parahaemolyticus in shrimp from Chinese retail markets. Food Control. 2014; 46:81-85.
31. Kshirsagar D, Brahmhhatt M, Chatur Y, Sinha N. Studies on occurrence and distribution of virulent strains of Vibrio Parahaemolyticus in finfishes and prawns from different ecosystem of Gujarat (India). J Vet Health Sci. 2013; 11(1):07-10.