Lactobacillus & Bifidobacterium of Patients with Strongyloidiasis Compared to the Control Group

Document Type : Original Articles

Authors

1 Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran.

2 Infectious Diseases Research Center, Kashan University of Medical Sciences, Kashan, Iran.

3 Department of Epidemiology and Biostatistics, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran.

10.61882/ARI.80.4.917

Abstract

In individuals with compromised immune systems, strongyloidiasis disease can lead to
disseminated infections that can be fatal if diagnosis and treatment are delayed. The human
gut is composed of numerous bacteria that play essential roles in the development of acquired
immunity, and protection against pathogenic factors.
This case-control study was conducted on individuals who were referred to the Diagnostic
Laboratory of Strongyloidiasis in the School of Public Health, Tehran University of Medical
Sciences. After DNA extraction from fecal samples, the 16SrRNA gene was examined using
Real-time PCR. The levels of Lactobacillus acidophilus and Bifidobacterium bifidium were
calculated in both groups (one group consisted of individuals suspected of strongyloidiasis
compared with the other group with no underlying disease). Finally, the collected data were
analyzed.
Out of 28 people participants in this study, 16 (57%) were men and 12 (43%) were women,
with age ranging from 43 to 76 years. A statistically significant relationship was observed
between underlying diseases, vegetable washing practices, and clinical symptoms of
strongyloidiasis. DNA extraction from the fecal samples was performed using the DNA
Extraction kit. The average level of L. acidophilus and B. bifidium were (4.07250±3.132533)
10 12 × and, (6.12857±3.519169) 10 12 × in the case group respectively, which were lower
compared to the control group but no significant association was found between the level of
bacterial in the case and control groups and the incidence of strongyloidiasis (p > 0.05), there
had (7.04733± 6.542372) 10 12 ×and (8.36643± 4.754185) 1012× respectively. The odds ratio
was L. acidophilus and B. bifidium 1.13 and 1.14, respectively.
It was observed that for each increase in the number of 10 12 in the microliter for
L.acidophilus and B. bifidium in the individual’s intestines in areas endemic for
strongyloidiasis, the chances of contracting this disease decreased by 13% and 14%,
respectively. Future studies with a higher volume considering age, gender and other
physiological factors related to strongyloidiasis are suggested.

Keywords


1. Introduction

Strongyloidiasis is a disease caused by infection with Strongyloides stercoralis (S.s), a soil-transmitted helminths (STH) ( 1 ). This parasite is prevalent in tropical and subtropical regions ( 2 ), with an estimated 613 million people infected worldwide ( 3 ). Control and elimination strategies aimed at reducing the complications of strongyloidiasis, are among the main goals of the World Health Organization (WHO) through 2030 ( 4 ). This nematode is endemic in the northern and southern provinces of Iran ( 5 ). S. stercoralis has a unique life cycle that includes both free-living and parasitic stages ( 6 ). Most patients with strongyloidiasis are chronic carriers without clinical symptoms ( 7 ). However, adult female worms reside deep in the intestinal crypts, where they lay eggs, potentially causing ileus paralysis. Larvae are dispersed throughout the ileum, causing mucosal damage and increasing mucus production, which can lead to edema and ultimately their atrophy. Symptoms include abdominal bloating, diarrhea, loss of appetite, malabsorption, steatorrhea (fatty stool), nausea, vomiting, and occasional constipation ( 7 , 8 ).

In immunocompromised individuals, parasite burden significantly increases, leading to hyperinfection syndrome and disseminated disease, in such cases can even lead to the death of the host ( 9 - 11 ). The human intestine is composed of a large number of microorganisms, predominantly bacteria, forming a highly complex and diverse ecosystem with extensive genetic diversity. The collection of these microorganisms, along with their genomes in the gastrointestinal tract, is referred to as the gut microbiome, which varies based on geography regions, ethnicity, endemic and non-endemic regions of various diseases ( 12 , 13 ). The gut microbiome plays a significant role in the functioning of both the acquired and innate immune system cells ( 14 ) and has a direct relationship with intestinal mucosal immunity ( 15 ).

Bacteria such as Lactobacillus and Bifidobacterium species are effective in improving the mucosal system of the digestive system and enhancing the host immune system ( 16 ). In recent years, the use of these bacteria as probiotics have increased, and scientific advances in fields such as sequencing, metagenomics, and bioinformatics have provided a research platform for studying the role of the microbiome and controlling physiological systems, including the digestive system, immunity, and metabolism ( 16 , 17 ). In this regard, it has been reported that the gut microbiome in untreated celiac patients have a significant reduction in Lactobacillus and Bifidobacterium compared to the control group ( 14 ).

Disruptions in the gut microbiota composition have been observed in gastrointestinal and systemic diseases such as autoimmune and allergic diseases, obesity, diabetes, and multiple myeloma ( 18 - 21 ). Intestinal worm parasites are harmful to human health due to nutritional competition with the host; therefore, worm infections can have broad effects on the host gut microbiome ( 22 - 24 ).

Recent studies confirm the hypothesis that infections with Ascaris spp, Trichuris trichiura, and hookworms in the gastrointestinal tract may play a positive or negative role in gut homeostasis by modulating the gut microbiome ( 25 , 26 ). In recent years, scattered studies in endemic areas of strongyloidiasis worldwide have reported that the gut microbiome in patients with strongyloidiasis differs compared to healthy groups ( 27 ). Additionally, changes in the gut microbiome of strongyloidiasis patients before and after treatment have also been reported ( 28 ).

The changes in microbiota in patients with strongyloidiasis raises the hypothesis that alterations, especially bacteria such as Lactobacillus and Bifidobacterium, which are effective in maintaining the gut immune system ( 14 ), may have an impact on the conversion of chronic forms of strongyloidiasis to acute forms or can be utilized as probiotic agents in the treatment of patients and reduction of gastrointestinal symptoms and complications. However, studies in this areas are very limited and apart from a few studies on other profiles of the gut microbiota ( 27 - 30 ), no study has yet addressed this question in Iran. Therefore, the present study was designed to investigate the levels of Lactobacillus and Bifidobacterium in the gut of patients with strongyloidiasis compared with the control group (non-strongyloidiasis) for the first time in Iran.

2. Materials and Methods

2.1. Ethical Approval

The project was approved by the Ethics Committee of Tehran University of Medical Sciences (IR.TUMS.SPH.REC.1402.178) We received written signed consent from all study participants.

2.2. Study Participants and Sample Collection

A case-control study was conducted between 2023-2024. The case group consisted of individuals suspected of strongyloidiasis who were referred to the Diagnostic Laboratory of Strongyloidiasis at the School of Public Health, Tehran University of Medical Sciences. The control group comprised volunteers who were matched in terms of age and gender with the case group with no underlying disease or digestive problems. A total of 28 people participated in this study, which was categorized into strongyloidiasis (n=14) and non- strongyloidiasis (n=14) groups.

Initial verbal consent was obtained from individuals in both groups, followed by the completion of a questionnaire containing demographic information and clinical symptoms. Subsequently, three fecal samples were collected from each participant (or one sample in case of non-cooperation), and examined using parasitological methods, including direct smear, formalin-ether concentration, and agar plate culture. Differentiation of S. stercoralis from other intestinal nematodes was performed based on the morphological characteristics of the larva ( 5 ). All fecal specimens, upon arrival at the microbiology laboratory, were transferred to a freezer and kept at −80°C.

2.3. Molecular methods

DNA extraction from the fecal samples was performed using the Vira Gene Total DNA Extraction kit (Cat. No: VTO-2050), following the manufacturer’s protocol. The investigation of the 16SrRNA gene for L. acidophilus and B. bifidum was conducted using primers (Table 1). L. acidophilus ATCC 4356, B. bifidum ATCC 29521 were used in this study as reference strains.

Target bacteria Primer Oligonucleotide sequence (5-3) Size (bp) Product size(bp) Reference
L.acidiphilus Primer F CCT TTC TAA GGA AGC GAA GGA T 22 129 *
Primer R ACG CTT GGT ATT CCA AAT CGC 21
B. bifidum Primer F CCACATGATCGCATGTGATTG 21 185 **
Primer R CCGAAGGCTTGCTCCCAAA 19
Table 1.16S rRNA primers used to analyze Lactobacillus acidiphilus and Bifid bacterium bifidum in fecal samples.

2.4. Real-Time PCR

PCR reactions were performed using the following reaction mixture: 10μL of 5 × 5X Real Time PCR master mix (High Rox amplicon),1 μM of each primer, 2 μL of DNA template, and 6 μL high-purity water in a final volume of 20 μL.

Amplification and detection were performed using an ABI Step One real-time PCR machine (Applied Bio Systems, Foster City, CA). The amplification program consisted of a holding stage step at 95°C for 30 seconds, followed by 40 cycles of 30 seconds at 94°C, and a combined annealing/extension step at 62°C for 30 seconds. Finally, the cycling stage is at 72°C for 60 seconds.

To assess the bacterial load in the samples, a standard curve was prepared using 0.5 McFarland) pure culture)of L. acidophilus and B. bifidum, and then the standard curve was plotted. Subsequently, serial dilutions of standard DNA strains of L. acidophilus and B.bifidum were prepared, and their OD 260/280 was measured using NanoDrop (Thermo Scientific, USA). Then, the results were read, and for Real-time PCR, 100 ng/µl of sample DNA from both case and control groups was used. After calculating the copy numbers of DNA present in the samples and preparing a series of consecutive dilutions from each of the prepared dilutions, 2 µl of each dilution was used in Real-time PCR reaction.

2.5. DNA Concentration and Copy Number Determination

Based on DNA concentration, copy numbers were calculated according to the following formula ( 31 ):

Number of copies (molecules)=Xng×6.0221×1023molecules/mole(N×660 g/mole)×1×109ng/g

Avogadro’s number=6.0221×1023

X= DNA concentration is calculated according to Ct and standard curve.

N= length in base pair: L. acidophilus (1.95 bp) and B. bifidum (2.3bp)

Weight average of a base pair (g/mole) = 660

2.6. Data Analysis.

Data analysis was performed via Stata Version 17 and Fisher's exact T test and Mann-Whitney U test, finally determining the Odds Ratio.  The significance level was considered at p-value <0 .05.

3. Results

16 males (57%) and 12 females (43%)participated in this study ,which was categorized into strongyloidiasis (n=14) and non-strongyloidiasis (n=14) groups based on their parasitological results. Their age ranged from 43 to 76 (mean= 65.36) years old. Based on parasitological methods, 14 individuals in the case group were positive for S. stercoralis.

In this study, 4 patients out of the case group had hyperinfection of strongyloidiasis. Participants in the study used tap water, regular water, and treated water for washing vegetables, and only 2 individuals out of all participants reported direct contact with soil, with one person mentioning contact with various animals.

In the case group, 7 individuals (50%) had at least one underlying disease, among whom diabetes was observed in 4 patients (28.57%) out of 14 patients in the case group. Individuals with strongyloidiasis predominantly exhibited gastrointestinal, respiratory and dermatological symptoms. Additionally, none of the patients in this study had larval currents. By reviewing the medical records of individuals with strongyloidiasis, eosinophilia was observed in 7 patients' records (50%), ranging from 7% to 29% (mean: 12%). Statistical analysis of demographic information and strongyloidiasis can be found in Table 2.

Variable Test P-Value
Age Fisher's p >0.05
Gender Fisher's p >0.05
Underlying disease Fisher's p >0.05
Diabetes Fisher's p < 0.05
Clinical symptoms Fisher's p >0.05
Washing vegetables Fisher's p < 0.05
Contact with soil Fisher's p >0.05
Contact with various animals Fisher's p >0.05
Table 2.Summary of the results that examined the relationship between demographic data and strongyloidiasis

However, a significant association was observed between the method of washing vegetables, clinical symptoms and underlying disease with strongyloidiasis  (p < 0.05).

3.1. Molecular results

Real-time PCR test based on the 16SrRNA gene for L. acidophilus and B. bifidum were performed using the ABI 7500 Real-Time PCR system (USA). Initially, standard curves for the 16SrRNA A genes were plotted using primers specific to this study, based on standard cultures of L. acidophilus and B. bifidum (Tables 3 and 4) (Figures 1 and 2).

ng.μl CT Mean
49.23 14.12 14.19 14.11 14.14
37.26 16.19 17.01 17.53 16.91
22.649 19.15 19.29 19.36 19.26667
11.364 24.36 24.45 24.5 24.43667
4.875 28.13 28.15 28.19 28.15667
Table 3.Standard Curve of 0.5 McFarland L.acidophilus.
ng.μl CT Mean
51.873 13.23 13.36 13.37 13.32
40.218 15.64 15.62 15.55 15.60333
33.678 19.43 19.76 19.7 19.63
25.471 22.36 22.29 22.31 22.32
12.319 25.32 25.36 25.41 25.36333
Table 4.Standard Curve of 0.5 McFarland B. bifidum.

Figure 1. Standard Curve Graph of L. acidophilus.

Figure 2. Standard Curve Graph of B. bifidum.

After conducting Real-time PCR tests, the Ct values for the case group for L. acidophilus ranged from 22.72 to 30.99 (with a mean of 26.65307 ± 2.513348), and for B. bifidum ranged from 20.16 to 29.16 (with a mean of 24.82079 ± 2.867510). In the control group, the Ct values for L. acidophilus ranged from 18.36 to 31.473 (with a mean of 25.93036 ± 4.141819) (Figures 3 and 4), and for B. bifidum ranged from 17.13 to 28.19 (with a mean of 22.93429 ± 3.853246) (Figures 5 and 6).

Figure 3. Comparison of L. acidophilus bacterial count and Ct values in the case and control groups in the present study.

Figure 4. Lactobacillus quantified by Real time qPCR and expressed as copy number in patient and healthy volunteers.

Figure 5. Comparison of B. bifidum bacterial count and Ct values in the case and control groups in the present study.

Figure 6. B. bifidum quantified by Real time qPCR and expressed as copy number in patient and healthy volunteers.

The average number of L. acidophilus and bifidum were (4.07250±3.132533) ×1012 and, (6.12857±3.519169) × 1012 in the case group respectively, which were lower than those in the control group, which had (7.04733± 6.542372)×1012 and (8.36643± 4.754185)×1012 respectively (Figures 3 and 4). However, with this sample size, various statistical analyses did not significant difference between the level of bacterial in the case and control groups and strongyloidiasis. In this study, the level of L. acidophilus was in the 40 - 59 age group (7.09±6. 43) ×1012 higher than the 60 - 79 age group (4.51±5.41) ×1012, and level of B. bifidum was in the 60 - 79 age group (5.3 (11.9-4.19)) × 1012 higher than the 40 - 59 age group (5.6 (10.9-3.9)) × 1012, but no significant association was observed between age and level of bacterial with strongyloidiasis (p > 0.05). There were 16 male and 12 female participants. Examining the level of L. acidophilus was higher in males (5.9 ± 6.07)× 1012 than in females (3.9± 4.6) 1012× , while the level of B. bifidum was higher in females (6.3 (12.5-5.2)) 1012× than in males (4.9 (10.1-3.4)) 1012×. However, no significant relationship was found between gender and level of bacteria (p > 0.05). Finally, the odds ratio were 1.13 for L. acidophilus and 1.14 for bifidum.

4. Discussion

The neglected intestinal nematode S. stercoralis, is the causative agent of strongyloidiasis ( 1 ). It can manifest in patients from asymptomatic carriage to hyperinfection and disseminated disease, depending on the host immune system ( 2 )

Bacteria are the most important component of the gut microbiome, playing a crucial role in maintaining gut homeostasis and both innate and acquired immune responses against pathogens ( 15 , 32 ). Recent studies have reported that helminthic infections in the gastrointestinal tract can lead to alterations in the gut microbiome ( 25 ). However, limited research has been conducted on the profiles of gut microbiota and strongyloidiasis in recent years worldwide ( 27 , 28 ). Additionally, no studies have been conducted in this regard in Iran. Therefore, the present study aimed to investigate the levels of Lactobacillus and Bifidobacterium in the intestines of patients with strongyloidiasis compared to a control group (individuals without strongyloidiasis) based on 16SrRNA gene, for the first time in Iran.

In the current study, two groups were examined: the case group and the control group, each consisting of 14 individuals matched for gender and age. In this study, no significant relationship was found between occupation, direct contact with soil, contact with various animals, and strongyloidiasis (p>0.05). However, a significant association was observed between the method of washing vegetables and the incidence of strongyloidiasis (p< 0.05). Individuals with strongyloidiasis predominantly exhibited gastrointestinal, respiratory and dermatological symptoms, and a significant correlation was found between clinical symptoms and strongyloidiasis in this study (p < 0.05). Furthermore, none of the patients in this study reported larval currents.

Based on this study, recent studies in Iran have reported that patients with strongyloidiasis present with at least one clinical symptom, including gastrointestinal, dermatological, or respiratory manifestations. The prevalence of clinical symptoms in some studies is consistent with our findings, encompassing gastrointestinal, respiratory, and dermatological symptoms ( 33 ).

Sometimes, contrary to our study, dermatological symptoms have been reported more frequently than respiratory symptoms ( 34 ). However, in these studies, no larval currents have been observed in any patients, which is consistent with our findings. In the present study, eosinophilia was observed in the medical records of 7 patients (50%), ranging from 7% to 29% (with a mean of 12%), which is consistent with previous studies conducted ( 33 , 34 ).

In the present study, the level of bacteria in the case groups was as follows: L. acidophilus and B. bifidum were calculated to be (4.07250 ± 3.132532) 1012× and (6.12857 ± 3.519169) 1012×, respectively. These counts were lower than those in the control group, which were (7.04733 ± 6.542372)×1012 and (8.36643 ± 4.754185)×1012 respectively. However, with this sample size, no significant association was found between the level of bacteria in the case and control groups and the incidence of strongyloidiasis (p > 0.05). In our study, the counts of L. acidophilus and B. bifidum in different age groups within the case and control groups showed that, despite the higher count of L. acidophilus in the age 40 - 59 years compared to 60-79 years and the higher count of B. bifidum in the age group of 60 - 79 years compared to 40 to 59 years, no significant association was found between age and bacterial counts with the incidence of strongyloidiasis (p > 0.05). Additionally, despite the higher count of L. acidophilus in men compared to women and the higher count of B. bifidum in women compared to men, no significant association was found between gender and bacterial counts in this study (p > 0.05).

Furthermore, by examining the 16SrRNA gene of the gut microbiome in individuals infected with soil-transmitted helminths during treatment with a single dose of albendazole (400 mg), a reduction in the gut microbiome of patients was observed 10 to 14 days after treatment. The results of this study suggested the possibility of using probiotic supplements as an adjunct therapy to enhance the effectiveness of albendazole ( 35 ). Additionally, in a study on children in a rural area in Thailand infected with soil-transmitted helminths such as Ascaris lumbricoides, Trichuris trichiura, and hookworms, the gut microbiome was examined before and after treatment using the V4 region of the 16SrRNA gene. Significant alpha diversity in the bacterial microbiome was not observed, but beta diversity, including an increase in Akkermansia muciniphila and Bacteroides corprophilus, and a decrease in Bifidobacterium adolescentis, was reported in these individuals ( 25 ).

By examining the 16SrRNA gene of the gut microbiome in individuals positive for S. stercoralis in northern Thailand before and after treatment, an increase in alpha diversity of the gut microbiota and a decrease in beta diversity in individuals positive for S. stercoralis compared to S. stercoralis-negative individuals were reported. In this study, individuals’ positive for S. stercoralis showed increased levels of fecal amino acids, while those negative for S. stercoralis showed increased levels of short-chain fatty acids in feces ( 27 , 36 ). Additionally, by investigating the effect of chronic strongyloidiasis infection on the gut microbiome of 42 volunteers (divided into two groups of patients and healthy individuals) based on the 16SrRNA gene, it was reported that Ruminococcus torques was more abundant in patients, suggesting that this increase may enhance the patient's ability to expel the parasite effectively. According to this study, chronic infection with S. stercoralis alters the proteomic composition of the host gut bacteria ( 28 ).

However, it should be noted that Bifidobacterium and Lactobacilli species have been identified as the best microbial options for enhancing the immune system in various studies ( 15 ). In the present study, the level of L. acidophilus compared to B. bifidum showed a greater difference between the case and control groups. However, ultimately, due to the low sample size, no significant relationship was observed between the level of bacterial and susceptibility to strongyloidiasis.

It was observed that for every increase of 1012 bacteria per microliter of L. acidophilus and B. bifidum in the intestines of individuals in endemic areas of strongyloidiasis, the chance of developing strongyloidiasis decreased by 13% and 14%, respectively. However, for a more comprehensive investigation of the relationship between the levels of L. acidophilus and B. bifidum in the gut of strongyloidiasis patients (taking into account their gender and age), a larger sample size from various geographical regions in different age groups will be required in future studies.

Acknowledgment

The authors would like to thank all the individuals who contributed to carrying out this work, especially Mr Hadi Sadeghi for their technical help. Also, the authors would like to thank the Clinical Research Development Unit of Kashan Shahid Beheshti Hospital.

Authors' Contribution

A. K: carried out the laboratory experiments, the prepared the draft of the manuscript. E.B.K: revision of the work, Editing of the manuscript. S. B. J: contributed to the conceptualization of the study. N.F: participated in data analysis and interpretation. E.D: Editing of the manuscript. Z. F. K*: article writing and study designed.

Ethics

This study was approved by the Ethics Committee of Tehran University of Medical Sciences (IR.TUMS.SPH.REC.1402.178). All stages of research were conducted following the Declaration of Helsinki. Written informed consent was obtained from the patient for publication of this case report.

Conflict of Interest

The authors declare that they have no competing interests.

Funding

The study was part of the M.S. thesis of the first author (Arezou Kazeminejad) and was supported by the Office of Vice Chancellor for Research at Tehran University of Medical Sciences (Grant number: No. 1402-3-295-67795).

Data Availability

All data generated are included in the current article.

References

  1. Olsen A, van Lieshout L, Marti H, Polderman T, Polman K, Steinmann P, et al. Strongyloidiasis–the most neglected of the neglected tropical diseases? Transactions of the Royal Society of Tropical Medicine and Hygiene. 2009; 103(10):967-72.
  2. Schär F, Trostdorf U, Giardina F, Khieu V, Muth S, Marti H, et al. Strongyloides stercoralis: global distribution and risk factors. PLoS neglected tropical diseases. 2013; 7(7):e2288.
  3. Buonfrate D, Bisanzio D, Giorli G, Odermatt P, Fürst T, Greenaway C, et al. The global prevalence of Strongyloides stercoralis infection. Pathogens. 2020; 9(6):468.
  4. Montresor A, Mupfasoni D, Mikhailov A, Mwinzi P, Lucianez A, Jamsheed M, et al. The global progress of soil-transmitted helminthiases control in 2020 and World Health Organization targets for 2030. PLoS neglected tropical diseases. 2020; 14(8):e0008505.
  5. Sharifdini M, Mirhendi H, Ashrafi K, Hosseini M, Mohebali M, Khodadadi H, et al. Comparison of nested polymerase chain reaction and real-time polymerase chain reaction with parasitological methods for detection of Strongyloides stercoralis in human fecal samples. The American journal of tropical medicine and hygiene. 2015; 93(6):1285.
  6. Grove DI. Human strongyloidiasis. Advances in parasitology. 1996; 38:251-309.
  7. Muller R, Wakelin D. Worms and human disease: CABi; 2002.
  8. Roberts L, Janovy J, Nadler S. Nematodes: trichinellida and dioctophymatida, enoplean parasites. Schmidt GD &amp; Roberts LS’s Foundations of Parasitology 9th edition McGraw-Hill, New York, USA. 2013; 381-8.
  9. Carvalho Filho EMd, Porto MAdF. Epidemiological and clinical interaction between HTLV-1 and Strongyloides stercoralis. 2004.
  10. Keiser PB, Nutman TB. Strongyloides stercoralis in the immunocompromised population. Clinical microbiology reviews. 2004; 17(1):208-17.
  11. Marcos LA, Terashima A, DuPont HL, Gotuzzo E. Strongyloides hyperinfection syndrome: an emerging global infectious disease. Transactions of the Royal Society of Tropical Medicine and Hygiene. 2008; 102(4):314-8.
  12. Hamady M, Knight R. Microbial community profiling for human microbiome projects: tools, techniques, and challenges. Genome research. 2009; 19(7):1141-52.
  13. Soliman A, Selim AO, Abd El-Tawab AA. The Effect of Some Nano Plant Extract on Bacteria Producing Biogenic Amines Isolated From Minced Meat. 2023.
  14. Mostafaei FSG, Hajihasani A, Eskandarian R, Yadegar A, Aghdaei HA, Zali MR. Changes in the composition and function of the gut microbiota in celiac disease. Koomesh. 2021; 23(3):301-16.
  15. Peterson DA, McNulty NP, Guruge JL, Gordon JI. IgA response to symbiotic bacteria as a mediator of gut homeostasis. Cell host & microbe. 2007; 2(5):328-39.
  16. Vuong HE, Yano JM, Fung TC, Hsiao EY. The microbiome and host behavior. Annual review of neuroscience. 2017; 40(1):21-49.
  17. Hills RD, Pontefract BA, Mishcon HR, Black CA, Sutton SC, Theberge CR. Gut microbiome: profound implications for diet and disease. Nutrients. 2019; 11(7):1613.
  18. Clemente JC, Ursell LK, Parfrey LW, Knight R. The impact of the gut microbiota on human health: an integrative view. Cell. 2012; 148(6):1258-70.
  19. Backhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI. Host-bacterial mutualism in the human intestine. science. 2005; 307(5717):1915-20.
  20. Sekirov I, Russell SL, Antunes LCM, Finlay BB. Gut microbiota in health and disease. Physiological reviews. 2010.
  21. Berer K, Gerdes LA, Cekanaviciute E, Jia X, Xiao L, Xia Z, et al. Gut microbiota from multiple sclerosis patients enables spontaneous autoimmune encephalomyelitis in mice. Proceedings of the National Academy of Sciences. 2017; 114(40):10719-24.
  22. Shea-Donohue T, Sullivan C, Finkelman FD, Madden KB, Morris SC, Goldhill J, et al. The role of IL-4 in Heligmosomoides polygyrus-induced alterations in murine intestinal epithelial cell function. The Journal of Immunology. 2001; 167(4):2234-9.
  23. Enobe CS, Araujo C, Perini A, Martins M, Macedo M, MACEDO‐SOARES MFd. Early stages of Ascaris suum induce airway inflammation and hyperreactivity in a mouse model. Parasite Immunology. 2006; 28(9):453-61.
  24. Girod N, Brown A, Pritchard D, Billett E. Successful vaccination of BALB/c mice against human hookworm (Necator americanus): the immunological phenotype of the protective response. International journal for parasitology. 2003; 33(1):71-80.
  25. Brosschot TP, Reynolds LA. The impact of a helminth-modified microbiome on host immunity. Mucosal immunology. 2018; 11(4):1039-46.
  26. Bajestani MS, Anvar SAA, Nowruzi B, Golestan L. Production of Cheese and Ice Cream Enriched With Biomass and Supernatant of Spirulina platensis With Emphasis on Organoleptic and Nutritional Properties. Iranian Journal of Veterinary Medicine. 2024; 18(2)
  27. Jenkins TP, Formenti F, Castro C, Piubelli C, Perandin F, Buonfrate D, et al. A comprehensive analysis of the faecal microbiome and metabolome of Strongyloides stercoralis infected volunteers from a non-endemic area. Scientific Reports. 2018; 8(1):15651.
  28. Tran NT, Chaidee A, Surapinit A, Yingklang M, Roytrakul S, Charoenlappanit S, et al. Chronic Strongyloides stercoralis infection increases presence of the Ruminococcus torques group in the gut and alters the microbial proteome. Scientific Reports. 2023; 13(1):4216.
  29. Fetouh M, Elbarbary H, Ibrahim E, Maarouf AA. Effect of adding lactoferrin on some foodborne pathogens in yogurt. 2023.
  30. Omran S, Barakat H, Muliira JK, McMillan S. Dietary and lifestyle risk factors for colorectal cancer in apparently healthy adults in Jordanian hospitals. Journal of Cancer Education. 2017; 32:447-53.
  31. Wang Y, Keith M, Leyme A, Bergelson S, Feschenko M. Monitoring long-term DNA storage via absolute copy number quantification by ddPCR. Analytical biochemistry. 2019; 583:113363.
  32. Farzaneh M, Fadaei V, Gandomi H. Antioxidant, Syneresis, and Sensory Characteristics of Probiotic Yogurt Incorporated With Agave tequilana Aqueous Extract. Iranian Journal of Veterinary Medicine. 2023; 17(3):243-52.
  33. Sharifdini M, Kia EB, Ashrafi K, Hosseini M, Mirhendi H, Mohebali M, et al. An analysis of clinical characteristics of Strongyloides stercoralis in 70 indigenous patients in Iran. Iranian Journal of Parasitology. 2014; 9(2):155.
  34. Nilforoushan M, Mirhendi H, Rezaie S, Rezaian M, Meamar A, Kia E. A DNA-based identification of Strongyloides stercoralis isolates from Iran. Iranian Journal of Public Health. 2007; 36(3):16-20.
  35. Appiah-Twum F, Akorli J, Okyere L, Sagoe K, Osabutey D, Cappello M, et al. The effect of single dose albendazole (400 mg) treatment on the human gut microbiome of hookworm-infected Ghanaian individuals. Scientific Reports. 2023; 13(1):11302.
  36. Pourbaba H, Anvar AA, Pourahmad R, Ahari H. Changes in acidity parameters and probiotic survival of the kefir using Lactobacillus acidophilus and Lactobacillus paracasei complementary probiotics during cold preservation. 2022.