Determination of ESBLs, pAmpC-beta-lactamase genes, and plasmid replicon types among Shigella species from different cities in Iran

Document Type : Original Articles

Authors

1 Medical Mycology and Bacteriology Research Center, Kerman University of Medical Sciences, Kerman, Iran.

2 Department of Medical Mycology and Parasitology, Afzalipour Faculty of Medicine, Kerman University of Medical Sciences, Kerman, Iran.

3 Student Research Committee, Kerman University of Medical Sciences, Kerman, Iran.

4 Medical Mycology and Bacteriology Research Center, Kerman University of Medical Sciences, Kerman, Iran

5 Department of Medical Microbiology (Bacteriology and virology), Afzalipour Faculty of Medicine, Kerman University of Medical Sciences, Kerman, Iran.

6 Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman, Iran.

Abstract

Shigella species (spp) are the common gram-negative bacilli isolated from patients with diarrhea. Infection treatment of these genus of bacteria due to increasing resistance to antibiotic agents remains a global challenge. Herein, we determined the frequency of ESBLs, plasmid-mediated AmpC-beta-lactamase (pAmpC) genes, and plasmid replicon types in 210 clinical isolates of Shigella spp from different cities in Iran. The antibacterial susceptibility of isolates to antibiotic agents and ESBLs production were determined according to the Clinical & Laboratory Standards Institute (CLSI) recommendations. ESBLs, pAmpC genes, and plasmid replicon types of isolates were detected using PCR and multiplex PCR methods. The highest rate of antibiotic resistance was observed to trimethoprim-sulfamethoxazole and the lowest rate of resistance was observed to cefoxitin. Fifty-four percent of the isolates were considered as ESBL-producers. Beta-lactamase genes including blaCTX-M, blaTEM, and blaDHA were detected in 93 (44%), 84 (40%), and 3 (1.4%) of isolates, respectively. Ten various plasmid replicon types including I1-Iγ, K, W, FIB, Y, P, FIC, FIA, HI1, and B/O were identified among the isolates. The study sheds light on the persistent challenges posed by multidrug-resistant (MDR) shigellosis to public health in different regions in Iran. Despite advancements in hygiene practices, the prevalence and population composition of Shigella species have remained largely unchanged. Also, the spread of beta-lactamase genes and various plasmid replicon types are increasing among the Shigella spp in our country which can be challenging to treat their infection and more efficient strategies, and monitoring should be considered to prevent the spread of them.

Keywords

Main Subjects


1. Introduction

Foodborne bacterial pathogens such as Shigella species (spp.) are among the most critical public health concerns around the world ( 1 ). The Shigella spp., including Shigella dysenteriae, Shigella flexneri, Shigella sonnei, and Shigella boydii are members of the Enterobacteriaceae family and cause acute gastroenteritis with high morbidity and mortality, especially in children in developing countries ( 2 ). Shigellosis, caused by Shigella spp., is an acute enteric infection that is usually characterized by watery and bloody mucoid diarrhea. It is highly contagious due to its low infectious dose. Antibiotic therapy, usually used for infants, the elderly, and immunocompromised patients, can reduce the duration and severity of shigellosis, as well as and the risk of transmission.

Ciprofloxacin, pivmecillinam, ceftriaxone, and azithromycin are antibiotic agents used for the treatment of shigellosis, especially in patients with bloody diarrhea ( 3 ). However, antibiotic resistance is increasing among Shigella spp. due to the misuse or overuse of antibiotic agents in the treatment of shigellosis, and multidrug resistant (MDR) Shigella isolates have been reported in some countries ( 4 ). The ability of this organism to acquire different antibiotic resistance genes through mobile genetic elements such as integrons, transposons, and plasmids is a major factor in the spread and emergence of MDR isolates.

Most MDR Shigella isolates are resistant to cephalosporins, ciprofloxacin, and azithromycin through acquired plasmid-mediated resistance mechanisms ( 4 ). Detection of ESBL- and AmpC- positive Shigella spp. is important because they are usually MDR and therapeutic options for them are limited. Hence, updating our data on the rate and mechanisms of resistance to antibiotic agents in Shigella spp. is essential for using effective and justified therapy to decrease the morbidity and mortality rates associated with shigellosis. Conjugative plasmids play an important role in the evolution and dissemination of antibiotic resistance and virulence factors among bacteria through facilitation of horizontal gene transfer ( 3 ). Due to the importance of Shigella spp. in causing gastrointestinal infections and the significant challenges in the treatment of infections resulting from MDR isolates, this study was conducted to investigate the presence of ESBLs, pAmpC beta-lactamase genes, and plasmid replicon types among Shigella isolates in different cities in Iran.

2. Materials and Methods

2.1. Sampling, Culture, and Shigella spp. isolates

This study was performed on 210 clinical isolates of Shigella spp. that were collected from patients with diarrhea (A single specimen each) and kept at -80 °C in Tryptic Soy Broth (TSB) supplemented with 30% glycerol from 2019 to 2021. The bacterial isolates were obtained from six cities in Iran--Ahvaz, Kerman, Shahr-e Kord, Tabriz, Urmia, and Ardabil-in Iran, and were confirmed using standard microbiological tests and polymerase chain reaction (PCR) with specific primers. The sequences and annealing temperatures of the primers are shown in Table 1.

Gene Primer sequence (5′-3′) Product size (bp) Annealing (°C) Use
Sboy F-TCTGATGTCACTCTTTGCGA 248 59 For confirmation S. boydii
R-GAATCCGGTACCCGTAAGGT
Sflex F-TTTATGGCTTCTTTGTCGGC 537 56 For confirmation S. flexneri
R-CTGCGTGATCCGACCATG
Sson F-AATGCCGTAAGGAATGCAAG 503 58 For confirmation S. sonnei
R-CTTGAAGGAGATTCGCTGCT
Sdys F-TCTCAATAATAGGGAACACAG 211 56 For confirmation S. dysenteriae
R-CATAAATCACCAGCAAGGTT
blaSHV F-TCAGCGAAAAACACCTTG 471 50 For detection of ESBL genes
R-TCCCGCAGATAAATCACC
blaTEM F- GAGTATTCAACATTTCGTGTC 861 60
R- TAATCAGTGAGGCACTATCTC
blaCTX-M F-CGCTTTGCGATGTGCAG 550 60
R-ACCGCGATATCGTTGGT
blaMOX F-GCTGCTCAAGGAGCACAGGAT 520 57 For detection of pAmpC genes using multiplex-PCR
R-CACATTGACATAGGTGTGGTGC
blaCIT F-TGGCCAGAACTGACAGGCAAA 462
R-TTTCTCCTGAACGTGGCTGGC
blaDHA F-AACTTTCACAGGTGTGCTGGGT 405
R-CCGTACGCATACTGGCTTTGC
blaACC F-AACAGCCTCAGCAGCCGGTTA 346
R-TTCGCCGCAATCATCCCTAGC
blaEBC F-TCGGTAAAGCCGATGTTGCGG 302
R-CTTCCACTGCGGCTGCCAGTT
blaFOX F-AACATGGGGTATCAGGGAGAT 190
R-GCAAAGCGCGTAACCGGATTGG
Table 1.The primer sequences are used for conformation of different species of Shigella.

2.2. Antimicrobial susceptibility of isolates and detection of ESBL-producing isolates

Disk diffusion method was used to evaluate the antibiotic susceptibility pattern of the isolates to different antibiotic agents (Padtan Teb Laboratory Instruments Co., Iran), including ceftazidime (CAZ, 30 μg), ampicillin (AMP, 10 μg), cefotaxime (CTX, 30 μg), cefoxitin (FOX, 30 µg), ceftriaxone (CRO, 30 μg), gentamicin (GEN, 10 µg), levofloxacin (LEV, 5 μg), amikacin (AMK, 30 μg), streptomycin (STR, 10 µg), ciprofloxacin (CIP, 5 μg), chloramphenicol (CHL, 30 μg), nalidixic acid (NAL, 30 µg), azithromycin (AZM, 15 μg), tetracycline (TET, 30µg), and trimethoprim-sulfamethoxazole (SXT, 1.25/23.75 μg), according to the Clinical and Laboratory Standards Institute (CLSI) guidelines ( 5 ). Shigella isolates that were resistant to one of the third-generation cephalosporins-including ceftazidime, cefotaxime, and ceftriaxone-were selected for confirmation of ESBL production according to CLSI guidelines, using the combination disc test with clavulanic acid ( 5 ).

2.3. DNA extraction

The DNA of the isolates was extracted using the boiling method. Briefly, a single colony from each isolate was suspended in 400 µL of DNase- and RNase-free water and heated at 100°C for 10 minutes. The lysates were then centrifuged at 12,000 × g for 10 minutes and the supernatants were used as the DNA template for PCR and multiplex PCR assays.

2.4. Detection of ESBLs and pAmpC among Shigella spp

ESBL resistance genes, including blaTEM, blaSHV, and blaCTX-M, were screened using PCR among ESBL-positive isolates. Cefoxitin-resistant isolates were also selected for identification of plasmid-mediated AmpC beta-lactamase genes, including blaMOXblaACCblaFOXblaCMY, blaEBC, and blaDHA, using a multiplex-PCR amplification technique previously described by Pérez-Pérez and Hanson ( 6 ). The PCR products were electrophoresed on 1.5% agarose gel for 45 minutes at 100 V, and the gels were analyzed usung a gel documentation imaging system. The sequence and annealing temperatures of the primers used for the detection of beta-lactamase genes are presented in Table 1.

2.5. Plasmid replicon type profiling

PCR-based plasmid replicon typing (PBRT) was performed based on the Carattoli et al., method, using 18 pairs of specific primers to identify replicons FIA, FIB, FIC, HI1, HI2, I1-Iγ, N, L/M, P, W, A/C, T, K, B/O, X, Y, FIIAs, and Frep in five multiplex-PCR and three simplex-PCR ( 7 ). The sequence of primers used in PBRT techniques is presented in Table 2.

Replicon type Primer sequence (5′-3′) Target site Amplicon size (bp)
HI1 F-GGAGCGATGGATTACTTCAGTAC parA-par B471
R-TGCCGTTTCACCTCGTGAGTA
HI2 F-TTTCTCCTGAGTCACCTGTTAACAC iterons 644
R-GGCTCACTACCGTTGTCATCCT
I1 F-CGAAAGCCGGACGGCAGAA RNAI 139
R-TCGTCGTTCCGCCAAGTTCGT
X F-AACCTTAGAGGCTATTTAAGTTGCTGAT ori g 376
R-TGAGAGTCAATTTTTATCTCATGTTTTAGC
L/M F-GGATGAAAACTATCAGCATCTGAAG repA,B,C 785
R-CTGCAGGGGCGATTCTTTAGG
N F-GTCTAACGAGCTTACCGAAG repA 559
R-GTTTCAACTCTGCCAAGTTC
FIA F-CCATGCTGGTTCTAGAGAAGGTG iterons 462
R-GTATATCCTTACTGGCTTCCGCAG
FIB F-GGAGTTCTGACACACGATTTTCTG repA 702
R-CTCCCGTCGCTTCAGGGCATT
W F-CCTAAGAACAACAAAGCCCCCG repA 242
R-GGTGCGCGGCATAGAACCGT
Y F-AATTCAAACAACACTGTGCAGCCTG repA 765
R-GCGAGAATGGACGATTACAAAACTTT
P F-CTATGGCCCTGCAAACGCGCCAGAAA iterons 534
R-TCACGCGCCAGGGCGCAGCC
FIC F-GTGAACTGGCAGATGAGGAAGG repA2 262
R-TTCTCCTCGTCGCCAAACTAGAT
A/C F-GAGAACCAAAGACAAAGACCTGGA repA 465
R-ACGACAAACCTGAATTGCCTCCTT
T F-TTGGCCTGTTTGTGCCTAAACCAT repA 750
R-CGTTGATTACACTTAGCTTTGGAC
FIIAS F-CTGTCGTAAGCTGATGGC repA 270
R-CTCTGCCACAAACTTCAGC
FrepB F-TGATCGTTTAAGGAATTTTG RNAI/repA 270
R-GAAGATCAGTCACACCATCC
K/B F-GCGGTCCGGAAAGCCAGAAAAC RNAI 160
R-TCTTTCACGAGCCCGCCAAA
B/O F-TCTGCGTTCCGCCAAGTTCGA RNAI 159
Table 2.The list of primers for plasmid replicon typing of isolates.

2.6. Statistical analysis

The results were statistically evaluated using SPSS software (version 24) and P-values ≤ 0.05 were considered statistically significant, based on the chi-square test and Fisher’s exact test.

3. Results

3.1. Shigella spp. isolates

In the present study, a total of 210 Shigella spp. isolates were collected from 6 different cities, including the cities Kerman [n= 64 (30.4%)], Ahvaz n=67 (33.5%)], Ardabil [n=18 (8.5%)], Urmia [n=19 (9%)], Tabriz [n=20 (9.5%)], and Shahr-e Kord [n=22 (10.4%)], where S. dysenteriae [n=5 (2%)], S. flexneri [n=102 (49%)], S. boydii [n=28 (13%)], and S. sonnei [n=75 (36%)] were reported. The prevalence of Shigella spp. in different cities in Iran is shown in Table 3.

Shigella spp. City; n (%)
Ardabil; 18 (%) Ahvaz; 67 (%) Kerman; 64 (%) Urmia; 19 (%) Shahre-kord; 22 (%) Tabriz; 20 (%)
S. dysenteriae 0 0 2 (3.1) 1 (5.3) 0 2 (10)
S. flexneri 10 (55.6) 27 (40.3) 34 (53.2) 8 (42.1) 10 (45.5) 13 (65)
S. boydii 4 (22.2) 10 (14.9) 9 (14.06) 1 (5.3) 3 (13.6) 1 (5)
S. sonnei 4 (22.2) 30 (44.8) 19 (29.6) 9 (47.3) 9 (40.9) 4 (20)
Total 18 (100) 67 (100) 64 (100) 19 (100) 22 (100) 20 (100)
Table 3.Prevalence of Shigella spp. in different cities in Iran.

3.2. Result of antimicrobial susceptibility

In this study, the resistance rate to antibiotic agents was as follows: trimethoprim-sulfamethoxazole (97%), streptomycin (94%), ampicillin (80%), tetracycline (77%), chloramphenicol (62%) and cefotaxime (57%), ceftriaxone (49%), nalidixic acid (31%), ceftazidime (30%), gentamicin (13%), azithromycin (12%), levofloxacin (6%), amikacin (6%), ciprofloxacin (6%), and cefoxitin (5%). Interestingly, all isolates were resistant to at least three classes of antibiotics and were considered MDR isolates. The rate of antibiotic resistance in different cities is presented in Table 4.

Antibiotic agents City; n (%)
Ardabil Ahvaz Kerman Urmia Shahre-kord Tabriz
Cefoxitin 6 (33.3) - 4 (6.2) - - 2 (10)
Ciprofloxacin 3 (16.66) 1 (1.4) 5 (7.8) 1 (5.2) 1 (4.5) 2 (10)
Ampicillin 17 (94.44) 42 (62.6) 57(89) 14 (73.6) 20 (90.9) 19 (95)
Gentamicin 8 (44.44) 2 (2.9) 8 (12.5) 4 (21) 4 (18.1) 2 (10)
Nalidixic acid 9 (50) 24 (35.8) 16 (25) 8 (42.1) 5 (22.7) 4 (20)
Levofloxacin 3 (16.6) 3 (4.4) 4 (6.2) - 3 (13.6) 1 (5)
Amikacin - 4 (5.9) 7 (10.9) - 2 (9) -
Streptomycin 13 (72.2) 64 (95.5) 64 (100) 18 (94.7) 22 (100) 18 (90)
Azithromycin 4 (22.2) 3 (4.4) 5 (7.8) 5 (26.3) 2 (9) 7 (35)
Tetracycline 9 (50) 63(94) 44 (68.7) 16 (84.2) 16 (72.7) 15 (75)
Trimethoprim-sulfamethoxazole 17 (94.44) 67 (100) 64 (100) 17 (89.4) 21 (95.4) 19 (95)
Chloramphenicol 2 (11.1) 14 (20.8) 26 (40.6) 6 (31.5) 4 (18.1) 4 (20)
Ceftriaxone 11 (61.1) 27 (40.2) 29 (45.3) 10 (52.6) 10 (45.4) 17 (85)
Cefotaxime 14 (77.7) 31 (46.2) 34 (53.1) 10 (52.6) 14 (63.6) 18 (90)
Ceftazidime 8 (44.4) 26 (38.8) 4 (6.2) 3 (15.7) 12 (54.5) 11 (55)
Table 4.The frequency of resistance to different antibiotic agents in different cities in Iran among Shigella spp.

3.2. Prevalence of ESBLs and pAmpC beta-lactamase genes (bla genes)

Based on the results, 114 isolates (54%) of the isolates were ESBL-positive, and blaTEM and blaCTX-M were detected in 84 (40%), and 93 (44%) of ESBL-positive isolates, respectively. blaDHA as one of the pAmpC-associated genes, was detected only in three isolates (1.4%): two isolates belonged to S. flexneri and one to S. sonnei. The prevalence of β-lactamase genes among Shigella spp. in different cities in Iran is shown in Table 5.

City β-lactamase genes, n (%)
blaCTX-M blaSHV blaTEM blaDHA
Ardabil (18) 11(61.1) 0 7 (38.8) 1 (5.5)
Ahvaz (67) 16 (23.8) 0 25 (37.3) 0
Kerman (64) 29 (45.3) 0 19 (29.6) 2 (3.1)
Urmia (19) 10 (52.6) 0 7 (36.8) 0
Shahr-e Kord (22) 10 (45.45) 0 14 (63.6) 0
Total (190) 76 (40) 0 72 (37.8) 3 (1.57)
Table 5.Prevalence of β-lactamase genes among Shigella spp in different cities in Iran.

3.3. Prevalence of plasmid replicon types

In this study, the replicon types I1-Iγ (72.8%), K (54.2%), W (47.1%), FIB (30.9%), Y (21.9%), P (13.3%), FIC (6.6%), FIA (4.2%), HI1 (1.9%), and B/O (1.4%) were reported. The Distribution of bla genes and plasmid replicon types among Shigella spp. in Kerman, Ardabil, Shahr-e Kord, Tabriz, Ahvaz, and Urmia, Iran, is presented in Tables 6 and 7.

City (n) Plasmid replicon types, n (%)
HI1 I1-Iγ FIA FIB W Y P FIC K B/O
Ardabil (18) 0 15 (83.3) 0 7 (38.8) 12 (66.6) 1 (5.5) 1 (5.5) 0 10 (55.5) 0
Ahvaz (67) 1 (1.4) 43(64.1) 5 (7.4) 18 (26.8) 12 (17.9) 1 (1.49) 0 0 33 (49.2) 2 (2.9)
Kerman (64) 0 48(75) 2 (3.1) 10 (5.6) 41 29 (45.3) 18 (28.1) 11 (17.1) 40 (62.5) 3 (4.6)
Urmia (19) 2 (10.5) 16 (84.2) 0 6 (31.5) 8 (42.1) 5 (26.3) 1 (5.2) 1 (5.2) 7 (36.8) 0
Shahre-kord (22) 1 (1.4) 15 (68.1) 0 14 (63.6) 14 (63.6) 5 (22.7) 4 (18.1) 4 (18.1) 11 (50) 0
Total (190) 4 (2.1) 137 (72.1) 7 (3.68) 55 (28.9) 87 (45.7) 41 (21.57) 24 (12.63) 16 (8.42) 101 (53.1) 5 (2.63)
Table 6.Prevalence of plasmid replicon types among Shigella spp in different cities in Iran.
City bla genes Species Replicon plasmid type profile
Ardabil blaTEM S. flexneri I1-Iγ, K
blaTEM S. flexneri I1-Iγ, FIB, K
blaCTX-M S. flexneri I1-Iγ, FIB, W, K
blaCTX-M S. flexneri I1-Iγ, FIB, W, Y, P
blaCTX-M S. flexneri I1-Iγ, FIB, W, K
blaCTX-M, blaTEM S. flexneri I1-Iγ, FIB, W, K
blaCTX-M, blaTEM S. flexneri I1-Iγ, K
blaCTX-M, blaTEM S. flexneri I1-Iγ, FIB, W
blaCTX-M S. sonnei I1-Iγ, FIB, W
blaCTX-M S. sonnei I1-Iγ, W, K
blaCTX-M, blaTEM S. sonnei I1-Iγ, W
blaCTX-M, blaTEM S. sonnei I1-Iγ, W
blaCTX-M S. sonnei I1-Iγ, FIB, W
blaCTX-M S. sonnei I1-Iγ, W, K
blaCTX-M, blaTEM S. boydii I1-Iγ, K
blaCTX-M, blaTEM S. boydii I1-Iγ, W
Urmia blaCTX-M, blaTEM S. flexneri I1-Iγ, FIB, W, FIC, K
blaCTX-M, blaSHV S. flexneri I1-Iγ, FIB, W
blaCTX-M, blaTEM S. sonnei I1-Iγ, FIB, W
blaCTX-M, blaTEM S. boydii I1-Iγ, W, Y
blaCTX-M S. sonnei I1-Iγ, FIB, W
blaCTX-M, blaTEM S. dysenteriae I1-Iγ, K
blaCTX-M S. flexneri I1-Iγ, FIB, W
blaCTX-M S. flexneri I1-Iγ Y, K
blaCTX-M, blaTEM S. flexneri I1-Iγ, FIB, W
Kerman blaTEM S. flexneri I1-Iγ, W
blaTEM S. flexneri I1-Iγ, Y, FIC, K
blaCTX-M, blaTEM S. flexneri I1-Iγ
blaCTX-M, blaTEM S. flexneri I1-Iγ
blaCTX-M, blaTEM S. flexneri I1-Iγ, W, Y, P
blaCTX-M, blaTEM S. flexneri I1-Iγ, K, B/O
blaCTX-M, blaTEM S. flexneri I1-Iγ, W, K
blaCTX-M, blaTEM S. flexneri I1-Iγ, W, Y, K
blaCTX-M, blaTEM S. flexneri I1-Iγ, W, Y, K
blaCTX-M, blaTEM S. flexneri I1-Iγ, K, B/O
blaCTX-M S. sonnei I1-Iγ, W, K
blaCTX-M S. sonnei I1-Iγ, FIB, W, Y, P, K
blaCTX-M S. sonnei I1-Iγ, W, K
blaCTX-M S. sonnei I1-Iγ, FIB, K
blaCTX-M S. sonnei I1-Iγ, FIB, Y, K
blaCTX-M S. sonnei I1-Iγ, FIA, FIB, W, K
blaCTX-M S. sonnei I1-Iγ, K, FIC, P, Y, W, FIB, FIA
blaCTX-M S. sonnei W, Y, P
blaCTX-M S. sonnei I1-Iγ, W, K
blaCTX-M S. sonnei I1-Iγ, B/O
blaCTX-M S. sonnei I1-Iγ, W
blaCTX-M S. sonnei I1-Iγ, W, Y, P, K
blaCTX-M S. sonnei K, FIC, Y
blaCTX-M S. sonnei I1-Iγ, W
blaCTX-M S. sonnei I1-Iγ, W, Y, P, K
blaCTX-M S. boydii I1-Iγ, FIC, K
blaCTX-M S. boydii I1-Iγ, W, P, K
blaCTX-M, blaTEM S. boydii I1-Iγ, W, Y, P, K
blaCTX-M, blaTEM S. boydii I1-Iγ, FIB, W
blaTEM S. sonnei I1-Iγ, K, FIC, P, Y, W, FIB, FIA
blaCTX-M S. sonnei K, FIC, Y
blaTEM S. sonnei I1-Iγ, W
blaTEM S. sonnei I1-Iγ, W, Y, P, K
blaCTX-M, blaTEM S. sonnei I1-Iγ, W, Y, P, FIC, K
blaCTX-M, blaTEM S. sonnei W, Y, P
blaCTX-M, blaTEM S. flexneri W, K
Ahvaz blaCTX-M, blaTEM S. flexneri I1-Iγ, K
blaCTX-M, blaTEM S. flexneri I1-Iγ
blaCTX-M, blaTEM S. flexneri I1-Iγ, K
blaCTX-M, blaTEM S. flexneri I1-Iγ, FIA
blaCTX-M, blaTEM S. flexneri I1-Iγ
blaCTX-M, blaTEM S. flexneri I1-Iγ, FIB
blaCTX-M, blaTEM S. flexneri W, FIA
blaTEM S. flexneri FIA
blaTEM S. sonnei I1-Iγ, FIB, K
blaTEM S. sonnei I1-Iγ, K
blaCTX-M, blaTEM S. sonnei I1-Iγ
blaCTX-M, blaTEM S. sonnei I1-Iγ, FIB
blaCTX-M, blaTEM S. sonnei I1-Iγ, FIB
blaCTX-M S. sonnei I1-Iγ, K
blaCTX-M, blaTEM S. sonnei I1-Iγ, FIB
blaCTX-M, blaTEM S. sonnei I1-Iγ, W
blaTEM S. boydii I1-Iγ, W, K
blaTEM S. boydii I1IY, W, K
blaTEM S. boydii I1-Iγ
blaTEM S. flexneri I1-Iγ, FIA, FIB, W
blaCTX-M S. sonnei I1-Iγ, FIB, K
blaCTX-M S. sonnei I1-Iγ
blaCTX-M S. sonnei I1-Iγ, K
blaCTX-M, blaTEM S. flexneri I1-Iγ, FIB
blaCTX-M S. flexneri I1-Iγ, K
blaTEM S. flexneri I1-Iγ, FIB, W
Tabriz blaCTX-M S. sonnei I1-Iγ, FIB, W, K
blaCTX-M S. sonnei I1-Iγ, FIB, W, Y
blaCTX-M S. sonnei I1-Iγ, FIB, W, P, K
blaCTX-M, blaTEM S. boydii I1-Iγ, FIA
blaCTX-M, blaTEM S. dysenteriae I1-Iγ, K
blaCTX-M S. flexneri I1-Iγ, Y, K
blaCTX-M S. flexneri I1-Iγ, K
blaCTX-M S. flexneri I1-Iγ, FIB, W, K
blaCTX-M, blaTEM S. flexneri I1-Iγ, FIB, W
blaCTX-M, blaTEM S. flexneri I1-Iγ, W, Y, P, K
blaCTX-M, blaTEM S. flexneri I1-Iγ, FIB, W
blaCTX-M, blaTEM S. flexneri I1-Iγ, K, B/O
blaCTX-M, blaTEM S. flexneri I1-Iγ, Y
blaCTX-M, blaTEM S. flexneri I1-Iγ
blaCTX-M, blaTEM S. flexneri I1IY, FIB, W, P, K
blaCTX-M S. flexneri W, Y, K
blaCTX-M, blaTEM S. sonnei I1-Iγ, FIB, W, K
blaCTX-M, blaTEM S. sonnei I1-Iγ, FIB, W, Y
Shahre-kord blaCTX-M, blaTEM S. flexneri I1-Iγ, FIB, W, K
blaCTX-M, blaTEM S. flexneri FIB, W, Y, P
blaTEM S. flexneri FIB, W
blaCTX-M, blaTEM S. sonnei I1-Iγ, FIB, W, K
blaCTX-M, blaTEM S. sonnei I1-Iγ, K
blaTEM S. sonnei I1-Iγ, K
blaTEM S. flexneri I1-Iγ, FIB, W
blaCTX-M S. sonnei I1-Iγ, FIB, W, K
blaCTX-M S. sonnei I1-Iγ, K
blaCTX-M S. sonnei I1-Iγ, K
blaCTX-M, blaTEM S. boydii I1-Iγ, FIB, W
blaCTX-M, blaTEM S. boydii I1-Iγ, FIB, W, Y, P
Table 7.Distribution of bla genes and plasmid replicon types among Shigella spp. in Kerman, Ardabil, Shahr-e Kord, Tabriz, Ahvaz, and Urmia in Iran.

4. Discussion

Shigellosis poses a considerable threat to global public health, with a particularly high prevalence in developing countries. Administering antibiotics has been shown to reduce both the severity and duration of the infection, as well as the excretion of the organism in feces, thereby aiding in the prevention of its continued transmission. This study offers insights into the molecular epidemiology of antibiotic resistance profiles, ESBLs, AmpC, and plasmid replicon types among Shigella spp. isolated from diarrheal samples in Iran. Top of Form.

In the current study, S. flexneri (49%) and S. sonnei (36%) were identified as the most common species, and our results were largely consistent with the results of recent studies in Iran and various countries ( 8 - 10 ). Between 2001-2019, several studies identified S. flexneri and S. sonnei as the predominant species of Shigella in Ahvaz and Tehran, Iran ( 8 , 9 ). Given that S. flexneri and S. sonnei are typically predominant in developing and developed countries, respectively, the findings of aforementioned studies are consistent with those of our own. The results of the current study showed that despite the high standard of hygiene in our region in recent years, we observed no noticeable change in the prevalence and population composition of isolated Shigella spp.

In recent years, an epidemiological transition in the prevalence of Shigella serogroups has been observed. Specifically, there has been a notable emergence of S. sonnei in regions where S. flexneri previously prevailed. This shift has been documented across various areas in Asia, Latin America, and the Middle East ( 10 ).

Notably, in the United States, S. flexneri was the predominant serotype in the early 1960s, but it was supplanted by S. sonnei between 1964 and 1968,  the cause of which remains unknown ( 10 ).

The increasing prevalence of S. sonnei in developing countries could potentially be attributed to improvements in water quality and sanitation practices. These improvements might limit the passive immunization typically conferred by P. shigelloides, which is commonly found in contaminated water sources. Furthermore, the amoeba Acanthamoeba castellani serves as a reservoir for S. sonnei, enabling its persistence even in highly chlorinated environments where S. flexneri struggles to thrive. Additionally, S. sonnei demonstrates a greater propensity for acquiring resistance compared to S. flexneri, giving it a competitive edge, particularly in regions with limited antimicrobial usage ( 11 ).

Shigella spp. can easily acquire and spread antimicrobial resistance genes, as in recent years, MDR-positive Shigella spp. have been reported abundantly  throughout the world. In this study, all isolates were resistant to at least three classes of antibiotics and were considered MDR. Also, 54% of isolates produced ESBL, which could be a serious threat to public health. The frequency of ESBL-producing Shigella isolates was reported to be 7.5% by Ranjbar et al., in 2013 ( 12 ) in Tehran, Iran, and the results of this study, in comparison to their findings, represented a significant increase in ESBL-producing Shigella isolates in other regions of Iran. In a cross-sectional study in Ardabil, Iran, from 2019 to 2020, 10.2% of Shigella species were ESBL positive, and various beta-lactamase genes including blaCTX-M and blaTEM were found among them ( 13 ). In another study in Tehran, Iran from 2015 to 2017 blaCTX-M-15 (10.7 %), blaSHV (28 %), and blaTEM (21.3 %) were reported among Shigella isolates ( 14 ). In the present study, blaTEM and blaCTX-M were the common ESBL genes among the isolates, with frequencies of 84 (40%) and 93 (44%), respectively, which is similar to findings in Argentina, Turkey, Lebanon, China, Korea, and Japan, where blaTEM and blaCTX were as the predominant ESBL genes in Shigella isolates ( 15 - 17 ).

This study revealed that more than 50% of the Shigella isolates exhibited resistance to ampicillin, tetracycline, trimethoprim-sulfamethoxazole, streptomycin, chloramphenicol, cefotaxime, and ceftriaxone. Many reports have highlighted a significant prevalence of resistance to ampicillin and trimethoprim-sulfamethoxazole among Shigella isolates, and based on these reports, trimethoprim-sulfamethoxazole and ampicillin are not appropriate choices for the treatment of shigellosis ( 18 , 19 ).

A high prevalence of resistance to nalidixic acid, trimethoprim/sulfamethoxazole, and ampicillin was reported in Shigella isolates among pediatric patients in different regions of Iran ( 14 ). Therefore, findings in different regions in Iran, similar to our results, showed that the rate of resistance to ampicillin, nalidixic acid, and trimethoprim/sulfamethoxazole is high.

In contrast to the findings by Xing et al. in China ( 18 ), in this study, resistance to nalidixic acid (31%) was low. This difference may be to the limited or nonexistent use of this drug in the treatment of shigellosis and other gastrointestinal tract infections in Iran. Gu et al., ( 20 ) demonstrated a significant increase in ciprofloxacin resistance in Asia and African countries over 12 years, whereas resistance to this antibiotic and third-generation cephalosporins was reported to be below 1% in the United States and some European countries. Ceftriaxone is presently the primary treatment for shigellosis in hospitalized patients. However, the irregular use of antibiotics has contributed to the development of resistant strains. Resistance to third-generation cephalosporins, particularly ceftriaxone, has been notably high in countries like Vietnam, China, and Iran. Despite reports of increasing antibiotic resistance in Shigella spp, the high resistance rate (49%) to ceftriaxone in this study is particularly noteworthy.

In a study conducted by Jafari et al., in 2009 ( 21 ) in Tehran, Iran, more than 90% of Shigella isolates were found to be susceptible to ceftriaxone, ceftazidime, cefepime, and ciprofloxacin. Conversely, Mostafavi et al., ( 22 ) reported a very high level of resistance among Shigella serotypes to trimethoprim-sulfamethoxazole, ampicillin, and third-generation cephalosporins. Furthermore, studies conducted in Iran over the past 20 years have consistently revealed a high level of resistance to trimethoprim-sulfamethoxazole and ampicillin ( 22 - 25 ).

In this study, a significant relationship was observed between all the S. sonnei strains and resistance to trimethoprim-sulfamethoxazole (P ≤ 0.5). Additionally, in the current study, S. boydii, S. flexneri, and S. dysenteriae strains exhibited a significant relationship with resistance to trimethoprim-sulfamethoxazole, ampicillin, and streptomycin (P ≤ 0.05). This may indicate a clonal spread of these strains due to the horizontal transfer of plasmids carrying multiple resistance genes in Iran. This highlights the key role of horizontal transfer of multidrug resistance genes associated with endemic plasmids. Overall, the low resistance to ciprofloxacin (6%) in this study suggests that fluoroquinolones remain effective for treating shigellosis in different regions of Iran. However, due to the limitations of fluoroquinolone prescription in children because of their side effects, some cephalosporins are often used as an alternative treatment for shigellosis.

The PBRT method is a practical tool for evaluating the genetic relatedness of bacterial isolate in epidemiological studies. In this study, plasmid profiling showed that 72.8% of isolates harbored I1-Iγ replicon type as the most abundant replicon type. I1-Iγ replicons are limited to Enterobacteria hosts carrying  the blaCTX-M, blaSHV, blaCMY, blaTEM genes, integrons and resistance genes to arsenic, tetracycline and streptomycin.

In the study by Ruekit et al.,( 26 ) conducted in India on 29 S. sonnei isolates, only B/O (34.4%) and I1-Iγ (13.7%) replicon types were reported, while in this study, I1-Iγ and B/O in were reported in 72.8% and 1.4% of isolates, respectively. Due to the geographical distribution and species diversity of isolates in this study, clonal dissemination of Shigella isolates carrying the I1-Iγ replicon is unlikely. Also, in the present study, most ESBL isolates carried the I1-Iγ replicon, so there may be a co-relationship between these two factors. The results of this study suggests that the I1-Iγ replicon is likely more compatible with ESBL-positive Shigella isolates than other plasmid replicon types.

In the present study, isolates harboring multi-replicon types were observed abundantly, such that among plasmid-carrying isolates, 59.3% harbored at least three replicons simultaneously. Also, two isolates, both belonging to S. soneii from Kerman, carried eight replicon types. The presence of multiple replicons among the isolates is one of the main factors in facilitating genetic exchanges, therefore, while increasing the chance of horizontal gene transfer among isolates (a broad host range), it also increases the possibility of genetic recombination between different plasmids within each isolate, which can drive the evolution and diversity of these bacteria, potentially leading to new pathogenicity and resistance profile.

In conclusion, the study sheds light on the persistent challenges posed by shigellosis to global public health. Despite advancements in hygiene practices, the prevalence and population composition of Shigella species remain largely unchanged. The epidemiological transition from S. flexneri to S. sonnei observed in various regions, underscores the dynamic nature of this infectious disease. Antimicrobial resistance among Shigella spp. poses a significant threat, with multi-drug resistance and ESBL-producing isolates increasing worldwide, which may reduce treatment options.

Notably, the high resistance rate to ceftriaxone in Iran underscores the urgent need for prudent antibiotic stewardship. Additionally, this study highlights the possible role of plasmid replicon types in the development and dissemination of resistance genes among Shigella isolates, and the spread of the I1-Iγ replicon, which is usually associated with ESBL genes, underscores the importance of understanding plasmid dynamics in combating antimicrobial resistance. However, despite the challenges posed by antimicrobial resistance, some antibiotics like ciprofloxacin remain effective for treating shigellosis, although its use is limited, especially in pediatric patients. Ongoing surveillance and appropriate use of antibiotic agents are essential for managing shigellosis caused by drug-resistant isolates.

Acknowledgment

The authors are grateful Department of Medical Microbiology (Bacteriology and Virology), Faculty of Medicine, Kerman University of Medical Sciences, Kerman, Iran.

Authors' Contribution

Study concept and design: SA. AM, D. K-N.

Acquisition of data: M. M, H. HN.

Analysis and interpretation of data: D. K-N, P. M, SA. AM.

Drafting of the manuscript: D. K-N, P. M, SA. AM.

Critical revision of the manuscript for important intellectual content: D. K-N, P. M.

Statistical analysis: D. K-N, P. M.

Administrative, technical, and material support: D. K-N.

Ethics

The present study with Reg. No. 97000972 was approved by the ethical committee of Kerman University of Medical Sciences, Kerman, Iran. The ethics approval code is IR.KMU.REC.1398.199.

Conflict of Interest

All authors of this manuscript have no conflicts of interest to disclose.

Funding

This study was supported by the Kerman University of Medical Sciences science grant number 97000972.

Data Availability

The datasets used or analyzed during the study are available on reasonable requests from the corresponding author (Email: d.kalantar@kmu.ac.ir).

References

  1. Organization WH. Microbiological Risk Assessment–Guidance for food. Food & Agriculture Org. 2021;36.
  2. Moxley RA. Enterobacteriaceae: Shigella. Vet Microbiol. 2022;100-7.
  3. Williams PCM, Berkley JA. Guidelines for the treatment of dysentery (shigellosis): a systematic review of the evidence. Paediatr Int Child Health. 2018; 38(sup1):S50-65.
  4. Wang Y, Ma Q, Hao R, Zhang Q, Yao S, Han J, et al. Antimicrobial resistance and genetic characterization of Shigella spp. in Shanxi Province, China, during 2006-2016. BMC Microbiol. 2019; 19:1-11.
  5. CLSI.  Performance Standards for Antimicrobial Susceptibility Testing. A CLSI supplement for Global Application M100. 33rd ed. Clinical and Laboratory Standards Institute; 2023. Available from: https://iacld.com/UpFiles/Documents/672a1c7c-d4ad-404e-b10e-97c19e21cdce.pdf
  6. Pérez-Pérez FJ, Hanson ND. Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR. J Clin Microbiol. 2002; 40(6):2153-62.
  7. Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 2005; 63(3):219-28.
  8. Nikfar R, Shamsizadeh A, Darbor M, Khaghani S, Moghaddam M. A study of prevalence of Shigella species and antimicrobial resistance patterns in paediatric medical center, Ahvaz, Iran. Iran J Microbiol. 2017; 9(5):277.
  9. Moosavian M, Ghaderiyan GH, Shahin M, Navidifar T. First investigation of the presence of SPATE genes in Shigella species isolated from children with diarrhea infection in Ahvaz, southwest Iran. Infect Drug Resist. 2019; 10(12):795-804.
  10. Qu M, Zhang X, Liu G, Huang Y, Jia L, Liang W, et al. An eight-year study of Shigella species in Beijing, China: serodiversity, virulence genes, and antimicrobial resistance. J Infect Dev Ctries. 2014; 8(7):904-8.
  11. Thompson CN, Duy PT, Baker S. The rising dominance of Shigella sonnei: an intercontinental shift in the etiology of bacillary dysentery. PLoS Negl Trop Dis. 2015; 9(6):e0003708.
  12. Ranjbar R, Ghazi FM, Farshad S, Giammanco GM, Aleo A, Owlia P, et al. The occurrence of extended-spectrum β-lactamase producing Shigella spp. in Tehran, Iran. Iran J Microbiol. 2013; 5(2):108.
  13. Sabour S, Teimourpour A, Mohammadshahi J, Peeridogaheh H, Teimourpour R, Azimi T, et al. Molecular detection and characterization of Shigella spp. harboring extended-spectrum β-lactamase genes in children with diarrhea in northwest Iran. Mol Cell Pediatr. 2022; 9(1):19.
  14. Soltan Dallal MM, Ranjbar R, Yaghoubi S, Rajabi Z, Aminharati F, Adeli Behrooz H. Molecular epidemiology and genetic characterization of Shigella in pediatric patients in Iran. Le Infez Med. 2018; 26(4):321-8.
  15. Andres P, Petroni A, Faccone D, Pasterán F, Melano R, Rapoport M, et al. Extended-spectrum β-lactamases in Shigella flexneri from Argentina: first report of TOHO-1 outside Japan. Int J Antimicrob Agents. 2005; 25(6):501-7.
  16. Xiong Z, Li T, Xu Y, Li J. Detection of CTX-M-14 extended-spectrum β-lactamase in Shigella sonnei isolates from China. J Infect. 2007; 55(5):e125-8.
  17. Alici O, Açikgöz ZC, Göçer S, Gamberzade S, Karahocagil MK. Short communication: prevalence of extended spectrum beta-lactamases in gram negative rods: data of 2001-2004 period. Mikrobiyol Bul. 2006; 40(4):355-61.
  18. Zhang J, Jin H, Hu J, Yuan Z, Shi W, Yang X, et al. Antimicrobial resistance of Shigella spp. from humans in Shanghai, China, 2004–2011. Diagn Microbiol Infect Dis. 2014; 78(3):282-6.
  19. Qu F, Bao C, Chen S, Cui E, Guo T, Wang H, et al. Genotypes and antimicrobial profiles of Shigella sonnei isolates from diarrheal patients circulating in Beijing between 2002 and 2007. Diagn Microbiol Infect Dis. 2012; 74(2):166-70.
  20. Gu B, Cao Y, Pan S, Zhuang L, Yu R, Peng Z, et al. Comparison of the prevalence and changing resistance to nalidixic acid and ciprofloxacin of Shigella between Europe–America and Asia–Africa from 1998 to 2009. Int J Antimicrob Agents. 2012; 40(1):9-17.
  21. Jafari F, Garcia-gil LJ, Salmanzadeh-ahrabi S, Shokrzadeh L. Diagnosis and prevalence of enteropathogenic bacteria in children less than 5 years of age with acute diarrhea in Tehran children ’ s hospitals. 2009; 70
  22. Mostafavi N, Bighamian M, Mobasherizade S, Kelishadi R. Resistance of Shigella strains to extended-spectrum cephalosporins in Isfahan province. Med J Islam Repub Iran. 2016; 17(30):428.
  23. Gebrekidan A, Dejene TA, Kahsay G, Wasihun AG. Prevalence and antimicrobial susceptibility patterns of Shigella among acute diarrheal outpatients in Mekelle hospital, Northern Ethiopia. BMC Res Notes. 2015; 8:1-7.
  24. Jamshidi AA, Matbooei A. Shigella spp frequency, serotyping and antibiotic resistance pattern in acute diarrheic patients in Zanjan Shahid Beheshti Hospital, during 2003-2007. J Adv Med Biomed Res. 2008; 16(62):77-84.
  25. Jomezadeh N, Babamoradi S, Kalantar E, Javaherizadeh H. Isolation and antibiotic susceptibility of Shigella species from stool samples among hospitalized children in Abadan, Iran. Gastroenterol Hepatol from bed to bench. 2014; 7(4):218.
  26. Ruekit S, Wangchuk S, Dorji T, Tshering KP, Pootong P, Nobthai P, et al. Molecular characterization and PCR-based replicon typing of multidrug resistant Shigella sonnei isolates from an outbreak in Thimphu, Bhutan. BMC Res Notes. 2014; 7:1-9.