Molecular and Bioassay Examination of Neospora Caninum Infection in Bovine Aborted Fetuses in Khorasan Razavi Province, Iran

Document Type : Original Articles

Authors

1 Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad,

2 Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad

3 Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi university of Mashhad

Abstract

Neospora caninum plays a significant role in causing abortion and reproductive failure in dairy cattle. The majority of neosporosis-related abortions take place during the 5–6 months of gestation. Fetal death in the uterus, resorption, mummification, autolysis, stillbirth, birth with clinical symptoms, or being born clinically healthy but with chronic infection are all possible outcomes. The objective of the study was to identify N. caninum infection in aborted bovine fetuses through molecular analysis and mouse bioassay testing. From 2019 to 2022, 121 bovine aborted fetuses were collected from dairy farms in Khorasan Razavi province. The fetal brain samples were screened for detection of the parasite DNA by polymerase chain reaction assay (PCR). In addition, a portion of PCR-positive brain tissue was homogenized and inoculated into the peritoneum of five BALB/c mice. All mice were sacrificed six weeks post infection and examined using serology, microscopic, and PCR methods. If the mice's brain samples were PCR positive, the mouse bioassay test was repeated two times. The N. caninum DNA was detected in 19.8% of brain samples in bovine aborted fetuses. Among PCR-positive brain samples, only ten samples were suitable for mouse bioassay examination. All inoculated mice were seronegative without clinical signs after three times bioassays, although the brain samples of three mice groups were PCR-positive after repeated bioassays. The PCR results showed a moderate frequency of Neospora infection in aborted bovine fetuses. Furthermore, the isolates obtained in this study had low pathogenicity in BALB/c mice. It seems the isolates belong to an avirulent strain

Keywords

Main Subjects


1. Introduction

Neospora caninum is recognized as the primary cause of abortion in cattle worldwide ( 1 ). There are two main ways of transmission for N. caninum in cattle. The main method of infection, often referred to as vertical, congenital, or endogenous transmission, occurs when bardyzoites of cysts in the dam’s tissues become active and transform into tachyzoites, which then cross through the placenta and infect the fetus. The secondary method, known as horizontal or post-natal transmission, happens when pregnant dairy cattle ingest sporulated N. caninum oocysts, allowing the sporozoites to transform into tachyzoites that likely disseminate through the circulation in cells of the mononuclear phagocytic system and potentially infect the fetus through transplacental transmission ( 4 ). Endogenous (vertical) transmission could occur in up to approximately 95% of infected dairy cattle ( 1 , 7 ).

The high seroprevalence of Neospora infection has been reported in dairy cattle in Iran ( 8 - 11 ). Accordingly, studies have shown that N. caninum infection also contributes to abortion in dairy cattle ( 14 , 15 ). Although there is a high prevalence of N. caninum infection in dairy cattle in Iran, only one N. caninum isolate has been recovered from an aborted bovine fetus ( 17 ). The present study aimed to detect the frequency of N.caninum infection in aborted bovine fetuses and evaluate the pathogenicity of N. caninum in BALB/c mice.

2. Materials and Methods

The study was conducted in Khorasan Razavi province, northern Iran, covering an area of over 127,000 km2 and located at coordinates 33°30′-37°41′ N; 56°19′-61°18′ E. This region experiences a semi-arid climate with a temperature zone characterized by cold winters and moderate summers There are approximately 25000 cattle distributed across 110 dairy farms in this region, with herd sizes ranging from 30 to 2000 cattle varying between farms. The predominant cattle breed in the area is Holstein-Friesian.

2.1. Sample collection

Between 2022 to 2023, a total of 121 aborted bovine fetuses were collected from different areas of the province. Thefetuses were necropsied, and brain tissue were collected for molecular and bioassay examination.

2.2. DNA Extraction and PCR

Samples were used to extract genomic DNA with the MBST Genomic DNA kit (Molecular and Biological Transmission Systems, Tehran, Iran) following the manufacturer's instructions. Then, we conducted a PCR assay to identify the N.caninum gene, following the previously described method by Müller et al 2002 ( 21 ). The simple PCR reaction was performed in a 25μl mixture containing 2μl of total DNA, 10μl of commercial premix master mix (Parstous Mashhad), 1μl of each primer, and 11μl of nuclease-free water in a thermocycler. The cycling process began with an initial denaturation step at 95°C for 5 minutes, followed by 40 cycles of 94°C for 1 minute, 63°C for 1 minute, and 74°C for 3.5 minutes, with a final extension step at 74°C for 10 minutes.

The Oligonucleotide primers used were NP21plus (5'CCCAGTGCGTCCAATCCTGTAAC3') and Np6plus (5'CTCGCCAGTCAACCTACGTCTTCT3').

2.3. Bioassay in Mice

Six to eight-week-old female BALB/c mice were obtained from the Razi Vaccine and Serum Research Institute (Mashhad Branch). The mice were housed in groups of five in plastic, cages with ad libitum access to rodent feed and water, under standard laboratory conditions. A total of 100 grams of brain tissue from PCR-positive aborted fetuses were homogenized in 500 ml of 0.85% NaCl solution (saline) containing antibiotics (100 IU/ml penicillin and 745 IU/ml streptomycin) and then homogenized using an electrical mixer. The mixture was subsequently filtered through two layers of gauze. After an incubation period of three hours at room temperature, the samples were then centrifuged at 1500 g for five minutes, and 5 ml of the homogenate deposit was administered intraperitoneally to 5 BALB/c mice (1 ml per mouse).

The mice were observed daily for any clinical signs indicating neosporosis. Blood samples were collected from the mice's tails six weeks after inoculation and their serum samples were analyzed using an Elisa kit (ID screen® N. caninum indirect Multi-species, ID. vet, Montpellier, France) to detect Neospora antibodies. All inoculated mice were euthanized 42 days post- infection using chloroform inhalation. Brain impression smears were prepared and examined under a microscope to detect cysts.

Additionally, a portion of the brain tissue was tested for N.caninum DNA using PCR. The PCR-positive brain samples from each group of mice were combined and then inoculated intraperitoneally into five BALB/C mice. These inoculated mice were monitored daily and euthanized seven weeks after inoculation.

During the necropsy, blood and brain samples were collected and analyzed using the serology and PCR methods as mentioned earlier. If the mice’s brain samples tested positive via PCR, the mice bioassay was repeated to once again identify a viable cyst.

3. Results

In this study, N.caninum DNA was detected in 19.8% (24/121) of brain samples from bovine aborted fetuses (Figure 1). Among 24 PCR-positive brain samples, only 10 were suitable for mouse bioassay examination.

Figure 1. PCR amplification products of N. caninum in brain samples Lanes: M: molecular weight marker (between 1000 and 100bp); p: positive control (Neospora tachyzoites; 337 bp); n: negative control; 5, 6: positive samples.

In the first bioassay round, all inoculated mice in ten groups were normal without clinical signs and the serology and microscopy results were also negative after 42 days post-infection. However, N.caninum -DNA was detected in five brain samples from two mice groups by PCR. Similar results were obtained after two rounds of mice bioassay examination using BALB/C mice inoculated with PCR-positive brain tissues from infected groups. (Table 1).

Results First round Second round Third round
Group (5 mice) bovine aborted fetuses (homogenized brain) Mice Mice
ELISA Microscopy PCR ELISA Microscopy PCR ELISA Microscopy PCR
1 N N N nd nd nd nd nd nd
2 N N N nd nd nd nd nd nd
3 N N P N N P N N P
4 N N P N N N nd nd nd
5 N N N nd nd nd nd nd nd
6 N N N nd nd nd nd nd nd
7 N N P N N P N N P
8 N N N nd nd nd nd nd nd
9 N N P N N N nd nd nd
10 N N P N N P N N P
P=Positive, N=Negative, nd= not done
Table 1.The results of first, second and third round of mouse bioassay examination on PCR -positive bovine and mice brain samples.

4. Discussion

In this study, N. caninum DNA was identified in 19.8% (24 out of 121) of brain samples collected from aborted bovine fetuses using the PCR method. The reported prevalence of N. caninum infection in aborted bovine fetuses across various provinces in Iran range from 12% to 67%, as determined by PCR techniques (Table 2).

province Study Year Method Number examined Number infected Frequency References
horasan Razavi 2007 PCR 6 4 67% 2
Khorasan Razavi 2010 PCR 151 18 12% 3
Khorasan Razavi 2013 PCR 200 23 12% 5
East Azerbijan 2013 PCR 14 6 43% 6
2013 PCR 100 11 11% 12
Tehran 2014 PCR 16 12 75% 13
Qazvin 2014 PCR 128 39 31% 16
East Azerbaijan 2018 PCR 82 34 41% 18
Markazi 2018 PCR 38 10 26% 19
Mazandaran 2019 PCR 9 2 22% 20
Mazandaran 2021 PCR 78 16 20.5% 22
Table 2.List of different studies frequency of N. caninum infection in brain tissue of aborted bovine fetuses in different areas of Iran.

A meta-analysis indicated that the prevalence of N. caninum in aborted fetuses was higher in studies with fewer than 50 samples compared to those with more than 50 samples ( 23 ). The author concluded that the pooled estimate for studies with a sample size of 50 or more could provide a more accurate, conservative, and reliable representation of the overall infection rates in aborted bovine fetuses in Iran ( 23 ).

The brain tissue of bovine aborted fetuses is the primary source of N.caninum isolation ( 24 ), but some studies have shown that most N.caninum cysts in brain tissue were probably non-viable due to autolysis effect ( 25 , 26 ). In this study, many positive brain samples were autolyzed after abortion, and only ten PCR-positive brain samples were suitable for bioassay examination. All inoculated mice in ten bioassay groups showed no clinical signs and no detectable Neospora cysts in their brain tissue. However, N.caninum DNA was detected in the brain samples of five mice in three bioassay groups. Similar results were obtained after conducting two additional rounds of mouse bioassays with PCR-positive brain samples. These findings suggest that these N.caninum isolates from aborted bovine fetuses were avirulent strains in BALB/C mice.

To date, virulent to avirulent strains of N. caninum have been reported by mice bioassay method ( 24 , 27 ).

The BALB/C models have been used to assess the pathogenicity of N. caninum isolates from bovine aborted fetuses. Some isolates demonstrated low virulence, with no clinical symptoms or detectable N.caninum cysts in the mice brains ( 28 - 31 ).

The PCR results confirmed the presence of N.caninum infection in the brain samples of aborted bovine fetuses and in two groups of inoculated mice. However, it remains unclear why no antibodies against N. caninum were found in the inoculated mice after three rounds of bioassays. Some studies also reported seronegative results for Toxoplasma gondii or N.caninum infection in different laboratory animals inoculated with infected mouse or rat brain tissue ( 32 , 33 ).

It has been suggested that the absence of clinical signs and detectable antibodies against to T.gondii or N.caninum infection may result from rapid death of parasites in mouse neural tissue of mice, but had DNA intact present. The duration between brain tissue collection and analysis might have been too lengthy to support the viable tissue cysts in the brain tissue ( 33 ). In summary, this research demonstrated the presence of N.caninum infection in brains of aborted bovine fetuses in the Mashhad region. The result strongly suggests a high frequency of endogenous transmission among dairy cattle in Iran. In addition, bioassay results provide further evidence that N.caninum isolates might be an avirulent strain and need more investigation.

Acknowledgment

We would like to thank Dr. Nargess Khleghnia and Dr. Darya Fazael for their assistance with sample collection from the submitted bovine aborted fetuses at the Excellence Research Center for Ruminant Abortion and Neonatal Mortality in Mashhad.

Authors' Contribution

Study concept and design: G.R.R.

Acquisition of data: G.R.R.

Analysis and interpretation of data: A.K., M.S.,

Drafting of the manuscript: G.R.R.,

Critical revision of the manuscript for important intellectual content: G.R.R.,A.K., M.S.,

Statistical analysis: G.R.R.,A.K., M.S.,

Administrative, technical, and material support: G.R.R.

Study supervision: G.R.R.,A.K., M.S.,

Ethics

The mice were housed and maintained according to the guidelines of the animal care facility at Ferdowsi University of Mashhad. All animal experiments were performed in strict accordance with the protocols approved by the Animal Ethics Committee of our faculty (IR.UM.REC.1399.063).

Conflict of Interest

The authors declare no conflict of interest.

Funding

This study was supported by Grant 3/45901 from the Vice President Research and Technology of Veterinary Medicine, Ferdowsi University of Mashhad, Iran.

Data Availability

The datasets generated and/or analyzed during this study are available from the corresponding author upon reasonable request.

References

  1. Dubey J, Schares G, Ortega-Mora L. Epidemiology and control of neosporosis and Neospora caninum. Clinical microbiology reviews. 2007; 20(2):323-67.
  2. Sadrebazzaz A, Habibi G, Haddadzadeh H, Ashrafi J. Evaluation of bovine abortion associated with Neospora caninum by different diagnostic techniques in Mashhad, Iran. Parasitology Research. 2007; 100(6):1257-60.
  3. Razmi GR, Zarea H, Naseri Z. A survey of Neospora caninum-associated bovine abortion in large dairy farms of Mashhad, Iran. Parasitology Research. 2010; 106(6):1419-23.
  4. Conraths J, Gottstein B. Neosporosis: general considerations. Protozoal abortion in farm ruminants, Wallingford: CAB international. 2007;42-45.
  5. Razmi GR, Zarae H, Nourbakhash M, Naseri Z. Estimating the rate of transplacental transmission of Neospora caninum to aborted fetuses in seropositive dams in Mashhad area, Iran. Iranian Journal of Veterinary Medicine. 2013; 7:253-256.
  6. Nematollahi A, Moghaddam G, Jaafari R, Helan JA, Norouzi M. Study on outbreak of Neospora caninum-associated abortion in dairy cows in Tabriz (Northwest Iran) by serological, molecular and histopathologic methods. Asian Pacific Journal of Tropical Medicine. 2013; 6(12):942-6.
  7. Wouda W. Neosporosis: Biology, transmission and clinical signs. Protozoal Abortion in Farm Ruminants Wallingford, England CAB international. 2007;46-53.
  8. Hajikolaei MH, Hamidinejat H, Ghorbanpoor M, Goraninejad S. Serological study of Neospora caninum infection in cattle from Ahvaz area, Iran. International Journal of Veterinary Research. 2008; 2(2): 63-66.
  9. Hadadzadeh HR, Shayan P, Vojgani M, Bolorchi M. Serological study of Neospora caninum in pregnant dairy cattle in Tehran, Iran. Iranian Journal of Veterinary Medicine. 2010; 4(2):113-116.
  10. Ansari-Lari M. Bovine neosporosis in Iran: a systematic review and meta-analysis. Preventive Veterinary Medicine. 2020; 176:104913.
  11. Gharekhani J, Yakhchali M, Berahmat R. Neospora caninum infection in Iran (2004–2020): A review. Journal of Parasitic Diseases. 2020; 44(4):671-86.
  12. Rafati N, Jaafarian M. The determination of prevalence of Neospora caninum in aborted fetuses in dairy cattle of Shahrekord area, Chahar Mahal Bakhtiari province, by Nested-PCR. Journal of Veterinary Laboratory Research. 2014; 6(1):45-50.
  13. Salehi N, Gottstein B, Haddadzadeh H. Genetic diversity of bovine Neospora caninum determined by microsatellite markers. Parasitology international. 2015; 64(5):357-61.
  14. Razmi GR, Maleki M, Farzaneh N, Talebkhan Garoussi M, Fallah A. First report of Neospora caninum-associated bovine abortion in Mashhad area, Iran. Parasitology Research. 2007; 100(4):755-7.
  15. Salehi N, Haddadzadeh H, Ashrafihelan J, Shayan P, Sadrebazzaz A. Molecular and pathological study of bovine aborted fetuses and placenta from Neospora caninum infected dairy cattle. Iranian Journal of Parasitology. 2009; 4(3):40-51.
  16. Kaveh A, Merat E, Samani S, Danandeh R, Nezad SS. Infectious Causes of Bovine Abortion in Qazvin Province, Iran. Archives of Razi Institute. 2017; 72(4):)225-30.
  17. Salehi N, Haddadzadeh H, Shayan P, Koohi MK. Isolation of Neospora caninum from an aborted fetus of seropositive cattle in Iran.  Veterinarski Arhive. 2012; 82(6):545-553.
  18. Hosseini A, Merat E, Samani S, Nezhad SS, Danandeh R. Comparison of Neospora caninum infected tissues in aborted fetal bovine by PCR.  Journal of Veterinary Research. 2018; 73:377-382.
  19. Khani M, Arabkhazaeli F, Hosseini SD, Shayan P. Molecular detection of Neospora caninum in aborted fetuses of cattle farms in Arak.  Journal of Veterinary Research. 2019; 73: 457-463.
  20. Amouei A, Sharif M, Sarvi S, Nejad RB, Aghayan SA, Hashemi-Soteh MB, et al. Aetiology of livestock fetal mortality in Mazandaran province, Iran. PeerJ. 2019; 6:e5920.
  21. Müller N, Zimmermann V, Hentrich B, Gottstein B. Diagnosis of Neospora caninum and Toxoplasma gondii infection by PCR and DNA hybridization immunoassay. Journal of Clinical Microbiology. 1996; 34(11):2850-2.
  22. Salehi B, Amouei A, Dodangeh S, Daryani A, Sarvi S, Safari-Kharyeki MR, et al. Molecular identification of Neospora caninum infection in aborted fetuses of sheep, cattle, and goats in Mazandaran Province, Northern Iran. Iranian Journal of Parasitology. 2021; 16(3):483.
  23. Ansari-Lari M. Neospora caninum in aborted bovine fetuses in Iran: a systematic review and meta-analysis. Annals of Parasitology. 2021; 67(3):357-66.
  24. Al-Qassab SE, Reichel MP, Ellis JT. On the biological and genetic diversity in Neospora caninum. Diversity. 2010; 2(3):411-38.
  25. Calarco L, Barratt J, Ellis J. Genome wide identification of mutational hotspots in the apicomplexan parasite Neospora caninum and the implications for virulence. Genome biology and evolution. 2018; 10(9):2417-31.
  26. Barr B, Anderson M, Blanchard P, Daft B, Kinde H, Conrad P. Bovine fetal encephalitis and myocarditis associated with protozoal infections. Veterinary Pathology. 1990; 27(5):354-61.
  27. Conrad P, Barr B, Sverlow K, Anderson M, Daft B, Kinde H, et al. In vitro isolation and characterization of a Neospora sp. from aborted bovine foetuses. Parasitology. 1993; 106(3):239-49.
  28. Lindsay D, Lenz S, Cole R, Dubey J, Blagburn B. Mouse model for central nervous system Neospora caninum infections. The Journal of Parasitology. 1995; 1:313-5.
  29. Miller C, Quinn H, Windsor P, Ellis J. Characterisation of the first Australian isolate of Neospora caninum from cattle. Australian Veterinary Journal. 2002; 80(10):620-5.
  30. Rojo-Montejo S, Collantes-Fernández E, Regidor-Cerrillo J, Álvarez-García G, Marugan-Hernández V, Pedraza-Díaz S, et al. Isolation and characterization of a bovine isolate of Neospora caninum with low virulence. Veterinary parasitology. 2009; 159(1):7-16.
  31. Dittrich RL, Regidor-Cerrillo J, Ortega-Mora LM, de Oliveira Koch M, Busch APB, Gonçalves KA, et al. Isolation of Neospora caninum from kidney and brain of a bovine foetus and molecular characterization in Brazil. Experimental parasitology. 2018; 185:10-16.
  32. Dubey J, Shen S, Kwok O, Thulliez P. Toxoplasmosis in rats (Rattus norvegicus): congenital transmission to first and second generation offspring and isolation of Toxoplasma gondii from seronegative rats. Parasitology. 1997; 115(1):9-14.
  33. Jenkins M, Parker C, Hill D, Pinckney R, Dyer R, Dubey J. Neospora caninum detected in feral rodents. Veterinary Parasitology. 2007; 143(2):161-5.