Molecular study of Hemiscorpius Peters (Scorpiones: Hemiscorpiidae) in Hormozgan province, South of Iran

1. Introduction

The family Hemiscorpiidae Pocock, 1893 (Arachnida: Scorpiones) consists of a single genus, Hemiscorpius, encompassing 17 globally described species ( 1 ), with seven of them distributed in Iran ( 2 ). All species reported in Iran have been characterized based on morphological studies. A morphological investigation of the Hemiscorpiidae family in Hormozgan province revealed the existence of three Hemiscorpius species including H. acanthocercus Monod & Lourenço, 2005, H. enischnochela Monod & Lourenco, 2005 and H. shahii Kovařík et al., 2017 ( 3 ). Limited research with molecular basis has been conducted on the Iranian scorpions, primarily focusing on Buthidae species. Mirshamsi et al. (2013) and Azghadi et al. (2014) revised the genus Odontobuthus Vachon, 1950 and described a new species ( 4 , 5 ). Jolodar (2019) sequenced the Cytochrome c oxidase subunit I (COI) gene of H. lepturus, collected from Khuzestan province ( 6 ). A simultaneous morphological and molecular study of Androctonus crassicauda (Olivier, 1807) was also conducted in Khuzestan ( 7 ). Jafari et al. (2020b) explored the molecular analysis of various Orthochirus Karsch, 1891 species (2020b) ( 8 ). Additionally, Soltan‑Alinejad et al. (2021) investigated six scorpion species molecularly ( 9 ). A study by Barahoei et al. (2022) involving morphological, morphometric, and molecular analysis of Odontobuthus resulted in the description of three new species ( 10 ). Scorpionism poses a health concern in specific countries, particularly Iran. Predominantly, scorpion stings in southern Iran are attributed to members of Hemiscorpius. Hemiscorpius lepturus Peters, 1861, is responsible for more than one-third of the annual stings in Ahvaz ( 11 , 12 ). The first death report by H. acanthocercus Monod & Lourenço, 2005, was documented in Hormozgan province ( 13 ). Different populations in regions with distinct weather conditions have different venom compositions ( 14 ). Consequently, available antivenoms lack proper efficacy for treating patients, underscoring the need to identify different species in each region to manage the treatment of patients. Given the morphological similarities among certain important species, there is an urgent demand for molecular investigation of these species. Several studies have used the COI gene sequences from different genera for the precise scorpion species determination ( 10 , 15 - 17 ). Furthermore, the COI gene has been useful for genealogical studies at the species level. Molecular studies not only affirm the validity of described species but also offer the potential to introduce new species and identify synonyms.

2. Materials and Methods

Hemiscorpius Peters (Scorpiones: Hemiscorpiidae) specimens were collected from Hormozgan province between 2021 to 2023. The samples were preserved in 96% ethanol and species were identified using the identification key ( 2 ) based on morphological traits. The second and third legs on the left side of the scorpion were separated and placed in tubes containing 99.8% ethanol. DNA extraction from the fixed tissue was carried out using the FavorPrep^TM Tissue Genomic DNA Extraction Mini Kit (Pingtung, Taiwan). A fragment of the COI was amplified by polymerase chain reaction (PCR) using two primers including LCO1490(GGTCAACAAATCATAAAGATATTGG) and HCO2198(TAAACTTCAGGGTGACCAAAAAATCA) ( 18 ). The thermal cycler profiles used for amplification were as follows: step1: 94°C for 2 minutes and 30 seconds; step 2 (35 cycles): 94°C for 45 seconds, 52°C for 60 seconds and 72°C for 60 seconds; step 3: 72°C for 5 minutes. Purification and sequencing of amplified genes were done by Niagene Noor Company (Tehran). The quantity and quality of the sequences were assessed by BioEdit 7.1.9 ( 19 ) and then prepared for further analysis. The nine newly generated COI sequences have been deposited in GenBank [http://www.ncbi.nlm.nih.gov] with the accession numbers OR803737 to OR803739, OR828045 to OR828049 and OR800364 (Table 1). Genetic distances within and between species were investigated with MEGA 7.0 ( 20 ). Bayesian inference (50,000,000 generations) implemented using the CIPRES website (http://www.phylo.org) and Maximum likelihood tree (10,000 iterations) on the website http://www.atgc-montpellier.fr/phyml (Guindon et al., 2010) were conducted. All voucher specimens are stored at the Research Institute of Zabol (RIOZ).

3. Results

The analysis involved nine sequences obtained from Hemiscorpius specimens collected in Hormozgan province and three sequences from the National Center for Biotechnology Information (NCBI) Odontobuthus tavighiae used as outgroup (Table 1). The aligned COI sequences are 628 bp in length, with 434 (69.1%) positions conserved, 194 (30.9%) variable, and 107 (17.03%) parsimony-informative. Both Bayesian inference (BL) and Maximum likelihood (ML) phylogenetic trees showed similar results. Hemiscorpius enischnochela was placed at the base of the tree (Figure 1), as an older species of the genus and a sister group of two other species (H.acanthocercus and H.lepturus). Hemiscorpius lepturus placed the sister group of H. acanthocercus as the newest species at the tip of the tree. These two species are morphologically similar to each other (Figure 1).

Figure 1. Bayesian inference (BI) was obtained by analysis of COI gene of Hemiscorpius spp. Odontobuthus tavighiae is used as outgroup. Posterior probability values from BI and bootstrap values from maximum likelihood (ML) analyses were added for each node, respectively.

The smallest genetic distance was observed between H. acanthocercus and H. enischnochela (0.081). Meanwhile, The highest genetic distance was between H. acanthocercus and Iraqian H. lepturus (0.112) (Table 2).

The genetic distances confirmed the validity of three species, namely H. acanthocercus, H. enischnochela, and H. lepturus (Table 2).

4. Discussion

Twenty-five samples of H. acanthocercus (9 samples), H. enischnochela (10 samples), H.lepturus (2 samples) and H. Shahii (4 samples) were utilized for COI gene sequencing. However, only nine sequences were obtained from these samples, including three sequences from H. acanthocercus, five sequences from H. enischnochela and one sequence from H.lepturus (Table 1, Figure 1). Samples collected over a year ago, such as H. Shahii in this study, did not yield successful sequencing. The storage conditions of samples also play an important role in sequencing. Successful sequencing may be unattainable in instances where the sample is desiccated, the ethanol amount is diminished, the ethanol quality is subpar, or the ethanol is excessively diluted. Optimal results are achieved by using live specimens or freshly fixed samples in 96 or 99% ethanol for less than 6 months. The findings of the study confirmed the validity of three species including H. acanthocercus, H. enischnochela, and H. lepturus (Figure 1; Table 2). Notably, Hemiscorpius lepturus was positioned as a sister group of H. acanthocercus, this two species are morphologically similar (Figure 2), having three trichobothria on the ventral surface of their pedipalp patella. In contrast, Hemiscorpius enischnochela (Figure 3) specimens were characterized by their lighter pigmentation and had 10-12 trichobothria on the ventral surface of their pedipalp patella. Hemiscorpius acanthocercus and H. lepturus are distributed in the east and west of the Zagros Mountains, respectively ( 3 ). In addition, both species have dangerous venom for humans resulting from their stings, with documented cases of fatalities ( 13 , 22 ). Given the variation in venom composition among different species, both the identification of each species within this genus and the range of distribution of each species are necessary for scorpion sting prevention and patient treatment, involving the development of specific antivenoms tailored to each species. In a study by Jolodar (2019), the COI sequence of H. lepturus was compared with another sequence from the H. lepturus collected from Izeh, Khuzestan province (accession number: KU341987.1) revealing a genetic distance of 0.06 between them ( 6 ). However, due to the shortness of the sequence, it was excluded from the present research. Similarly, the sequence of H. persicus Birula, 1903 (accession number: KU341988.1) was not utilized in this study as it displayed complete similarity to the sequence belonging to H. lepturus (accession number: KU341987.1). The genetic distance observed within and between species of the Hemiscorpiidae family surpasses that of the Buthidae family (Table 2). The genetic distance between Iranian and Iraqian samples of H.lepturus (0.092) is too large (Table 2), potentially contributing to the limited number of sequences available for these species of each population and the absence of sequences for all species within this genus. Therefore, sequencing other species within this genus is necessary. Once the sequences of all species have been examined, a comprehensive discussion of this matter can be conducted. Additionally, it raises the possibility to propose the scenario regarding the origin of the Hemiscorpius genus and the distribution map of its species in the plateau of Iran.

Figure 2. Habitus of a female alive specimen of Hemiscorpius acanthocercus collected from Hormozgan province, Bandar Abbas County, Geno village.

Figure 3. Habitus of a female alive specimen of Hemiscorpius enischnochela collected from Hormozgan province, Bandar Abbas County, Geno village.

Acknowledgment

This study was funded by the Vice-Chancellor for Research and Technology at Hormozgan University of Medical Sciences, Iran. The authors would like to express their sincere gratitude for the invaluable support provided by this deputy, which was instrumental in the successful completion of our research.

Authors' Contribution

Collecting samples and revising the manuscript: Mehran Shahi. Laboratory operations, drafting the manuscript, and correspondence: Hossein Barahoei. All authors read and approved the final version of the manuscript.

Ethics

The protocol was accepted by the Research Institute of Zabol, Zabol, Iran.

Conflict of Interest

The authors affirm that there is no conflict of interest concerning the publication of this paper.

Grant Support

This research was granted by the Hormozgan University of Medical Sciences, Project No. 990502 (IR.HUMS.REC.1400. 099).

References

1. Rein JO. The scorpion files. Retrieved from: https://www.ntnu.no/ub/scorpion-files. 2023.
2. Barahoei H, Navidpour Sh, Aliabadian M, Siahsarvie R, Mirshamsi O. Scorpions of Iran (Arachnida: Scorpiones): Annotated checklist, DELTA database and identification key. Journal of Insect Biodiversity and Systematics. 2020; 6(4):375-474.
3. Shahi M, Barahoei H. Morphological study of Hemiscorpius Peters, 1861 (Scorpiones: Hemiscorpiidae) in Hormozgan province, Southern Iran. Archives of Razi Institute. 2023.
4. Mirshamsi O, Azghadi S, Navidpour Sh, Aliabadian M, Kovařík F. Odontobuthus tirgari sp. nov. (Scorpiones, Buthidae) from the eastern region of the Iranian Plateau. Zootaxa. 2013; 3731(1):153-170.
5. Azghadi S, Mirshamsi O, Navidpour Sh, Aliabadian M. Scorpions of the genus Odontobuthus Vachon, 1950 (Scorpiones: Buthidae) from Iran: Phylogenetic relationships inferred from mitochondrial DNA sequence data. Zoology in the Middle East. 2014; 60(2):169-179.
6. Jolodar A. Molecular characterization and phylogeny analysis based on sequences of cytochrome oxidase gene from Hemiscorpius lepturus of Iran. Iranian Journal of Veterinary Research. 2019; 13(1):59-67.
7. Jafari H, Salabi F, Navidpour Sh, Forouzan A. Phylogenetic and Morphological Analyses of Androctonus crassicauda from Khuzestan Province, Iran (Scorpiones: Buthidae). Archives of Razi Institute. 2020; 75(3):405-412.
8. Jafari H, Salabi F, Forouzan A. A study of genetic diversity among different population of Orthochirus sp. based on cytochrome C oxidase subunit I and 16srRNA sequencing. Turkish Journal of Zoology. 2020; 44: 64-68.
9. Soltan‑Alinejad P, Rafinejad J, Dabiri F, Onorati P, Terenius O, Chavshin AR. Molecular analysis of the mitochondrial markers COI, 12S rDNA and 16S rDNA for six species of Iranian scorpions. BMC Research Notes. 2021; 14(40): 1-6.
10. Barahoei H, Prendini L, Navidpour Sh, Tahir HM, Aliabadian M, Siahsarvie R, Mirshamsi O. Integrative systematics of the tooth-tailed scorpions, Odontobuthus (Buthidae), with descriptions of three new species from the Iranian Plateau. Zoological Journal of the Linnean Society. 2022; 195(2): 355-398.
11. Mohseni A, Vazirianzadeh B, Hossienzadeh M, Salehcheh M, Moradi A, Moravvej SA. The roles of some scorpions, Hemiscorpius lepturus and Androctonus crassicauda, in a scorpionism focus in Ramhormorz, southwestern Iran. Journal of insect science. 2013; 13(89): 1-12.
12. Rahmani AH, Forouzandeh H, Kalantar M, Asad-Masjedi N, Alavian Z, Kavarizadeh K. Epidemiological and clinical characteristics of scorpion stings in Ahwaz, Southwest Iran 2006-2010. International Journal of Medical Toxicology and Forensic Medicine. 2015; 5(4 ): 201-216.
13. Shahi M, Rafinejad J, Az-Khosravi L, Moosavy SH. First report of death due to Hemiscorpius acanthocercus envenomation in Iran: Case report. Electron Physician. 2015; 7(5):1234-1238.
14. Akbar N, Sajjad A, Rizwan S, Munir S, Mehmood K, Ali SA, Rakhshanda AM, Zahid H. Scorpion’s Biodiversity and Proteinaceous Components of Venom. International Journal of Biosciences. 2021; 18(2):146-162.
15. Alqahtani AR, Badry A. Genetic diversity among different species of the genus Leiurus (Scorpiones: Buthidae) in Saudi Arabia and the Middle East. Saudi Journal of Biological Sciences. 2020; 27(12):3348-3353.
16. Cain S, Gefen E, Prendini L. Systematic revision of the sand scorpions, genus Buthacus Birula, 1908 (Buthidae CL Koch, 1837) of the Levant, with redescription of Buthacus arenicola (Simon, 1885) from Algeria and Tunisia. Bulletin of the American Museum of Natural History. 2021; 450(1):1-134.
17. Kovařík F, Fet V, Gantenbein B, Graham MR, Yağmur EA, Šťáhlavský F, Poverennyi NM, Novruzov NE. A revision of the genus Mesobuthus Vachon, 1950, with a description of 14 new species (Scorpiones: Buthidae). Euscorpius. 2022; 348:1-189.
18. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology. 1994; 3(5):294-299.
19. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series. 1999; 4:95-98.
20. Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution. 2016; 33:1870-1874.
21. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3. Systematic Biology 2010; 59(3):307-21.
22. Jalali A, Pipelzadedh MH, Sayedian R, Rowan EG. A review of epidemiological, clinical and in vitro physiological studies of envenomation by the scorpion Hemiscorpius lepturus (Hemiscorpiidae) in Iran. Toxicon. 2010; 55(2-3):173-179.