1. Introduction
The order Scorpiones includes 1,259 described species that are placed in 16 families and 155 genera ( 1 ). Iranian scorpions are considered one of the most diverse populations in the region of Southwest Asia. Therefore, conducting various studies to identify the species in the region is important.
Scorpio maurus L., 1758, is a small to medium-sized scorpion that belongs to the Scorpionidae family. It is found in countries such as Morocco across Northern Africa, through the Arabian Peninsula and the Middle East, including Israel, Syria, Jordan, and Turkey, to as far East as Iraq and Iran. This scorpion is also known as "yellow digger scorpion" or "broad fork scorpion". Most species of S. maurus have a yellow to red-brown color. Dark brown to black color has also been reported in some subspecies. This type of scorpion is mostly found in desert and dry areas, although it has also been observed in thin forests. This scorpion is a digger and digs different holes based on the type of habitat. Birula first examined the entire population of S. maurus in North Africa and the Middle East. His research showed that most types of S. maurus are subspecies; however, he classified them all into two large groups: sectio maurus and sectio propinquus. There are many subspecies of this scorpion, 19 of which were described by Birula ( 2 ).
Classifying arthropods based on morphological characteristics has been used for many years. However, the studies using the sequence of mitochondrial 12S and 16S ribosomal DNA, cytochrome oxidase subunit 1 and nuclear 28S ribosomal DNA, along with the use of morphological characteristics, are considered to be among the best lineage identification studies in scorpions ( 3 - 5 ). Among the macromolecules used for phylogenic studies, 16srRNA is the most useful for establishing phylogenic distances. Ribosomal RNA genes are essential for the survival of all organisms. Therefore, the nucleotides in these genes are highly protected and have a slower evolution rate than other genes. Since this gene has the most genetic information, conservative nature, and universal distribution, it is used as a standard method for the identification and taxonomy of the border between species ( 6 ). Species diversity has been studied based on morphological characteristics and the structure of dug nests in S. maurus palmatus population in different geographical areas in Egypt ( 7 ). The first preliminary survey of S. maurus scorpion population in Turkey using a part of the cytochrome oxidase gene showed the complexity of this species ( 8 ). A preliminary analysis based on the cytochrome oxidase gene in scorpions of the genus Scorpio in Morocco showed a high level of genetic diversity in association with geographic cohesion ( 9 ). Using three mitochondrial markers, six species of medically important Iranian scorpions, including S. maurus, were surveyed ( 10 ).
The lack of systematic studies on S. maurus in Iran has made its taxonomic status and geographical distribution unclear. In this study, the taxonomic status of this scorpion was determined based on the sequence of the 16srRNA gene fragment.
2. Materials and Methods
2.1. Collection of scorpion specimens
Specimens of S. maurus were collected overnight using ultraviolet light (UV) from Behbahan, located east of Khuzestan Province, which is considered a habitat for this type of scorpion. Three scorpion specimens from Behbahan were recorded along with the longitude and latitude of the sampling areas using a location tracking device called Global Positioning System (GPS).
2.2. Sampling and morphological measurements
Morphological characteristics, including color, pedipalp, prosoma, metasoma, and trichobothria patterns, have been studied using a stereomicroscope (Leica MZ 7.5, Germany). The morphological measurements were taken using digital calipers.
2.3. Genomic DNA extraction
To extract genomic DNA, 0.1-0.5 g of scorpion foot tissue was crushed in the presence of liquid nitrogen; then, 600 μl of resuspension buffer (10 mM Tris-HCl pH 7.4/10 mM NaCl/25 mM ethylenediaminetetraacetic acid was added, and the mixture was homogenized. Genomic DNA was extracted with the same amount of phenol/chloroform and once with the same amount of chloroform. Finally, it was precipitated with pure ethanol and 3M of sodium acetate.
2.4. Polymerase chain reaction (PCR) amplification and sequencing
To amplify the target gene fragments, polymerase chain reaction (PCR) for each sample in a final volume of 25 μl containing 350 ng DNA template, 1 X PCR buffer, deoxyribonucleotide triphosphates (0.25 mM), magnesium chloride (1.5 mM), forward and reverse primer (each 0.4 mM), Taq DNA polymerase (0.5 U). Polymerase chain reaction thermal program was performed at 95°C for 3 min (one cycle), 94°C for 45 sec, 45°C for 45 sec, and 72°C for 60 sec (5 cycles); subsequently, at 94°C for 45 sec, 51°C for 60 sec, and 72°C for 60 sec (35 cycles); and finally, at 72°C for 10 min as a final extension. The primers were ITS2F 5'-CGATTTGAACTCAGATCA and ITSR 5'- GTGCAAAGGTAGCATAATCA ( 15 ). The amplified PCR products were subjected to electrophoresis through a 1% agarose gel and stained with DNA Safe Stain (Sinaclon, Iran) before detection by UV transillumination. The amplified DNA fragments were extracted from agarose gel before the performance of DNA sequencing according to the dideoxy termination method using an automated Applied Biosystems 373 DNA Sequencer.
2.5. Genetic distance and phylogenetic tree
The comparisons of DNA sequences were conducted using the BLAST algorithms programs in the National Center for Biotechnology Information (NCBI) GenBank database. The alignments of multiple sequences were obtained using the CLUSTAL_W program ( 11 ). Genetic distance and phylogenetic tree were performed using the Neighbor-Joining method with p-distance value via 1,000 replicates of bootstrapping using the MEG7 software ( 12 ).
3. Results
3.1. Collection of scorpion specimens and morphology
Specimens of S. maurus were collected at night using ultraviolet light from Behbahan, located in the east of Khuzestan province, with longitude and latitude 50°12'17"E and 30°14'46"N, respectively. Behbahan, the place where the specimens were collected, is shown on the map (Figure 1). After transferring the specimens to the lab, they were identified using morphological identification keys ( 13 - 14 ). The maximum size of these scorpions reaches 6.5 cm in maturity. The color of the body is yellow to pale brown and can be seen with bright pincers and legs. The tail is shorter than the body and covered with hairs. In the first segment of the tail, the width is greater than the length, but gradually, the length of the segments increases (Table 1).
Figure 1. Collection site of the S. maurus scorpions. The specimens from Behbahan is shown on the map along with the location of two reference sequences with accession numbers MH170444 and KU705354 that were isolated from Miandoab and Mahabad, respectively
| Taxonomy | Number of hits | Number of Organisms | Taxonomy |
|---|---|---|---|
| Scorpionidae | 116 | 27 | |
| . Scorpio | 49 | 6 | |
| . . Scorpio maurus | 3 | 1 | Scorpio maurus hits |
| . . Scorpio fuscus | 18 | 1 | Scorpio fuscus hits |
| . . Scorpio kruglovi | 3 | 1 | Scorpio kruglovi hits |
| . . Scorpio palmatus | 19 | 1 | Scorpio palmatus hits |
| . . Scorpio propinquus | 4 | 1 | Scorpio propinquus hits |
| . . Scorpio fuliginosus | 2 | 1 | Scorpio fuliginosus hits |
| . Heterometrinae | 64 | 18 | |
| . . Heterometrus | 43 | 8 | |
| . . . Heterometrus petersii | 2 | 1 | Heterometrus petersii hits |
| . . . Heterometrus longimanus | 6 | 1 | Heterometrus longimanus hits |
| . . . Heterometrus spinifer | 7 | 1 | Heterometrus spinifer |
| . . . Heterometrus silenus | 5 | 1 | Heterometrus silenus |
| . . . Heterometrus laoticus | 8 | 1 | Heterometrus laoticus |
| . . . Heterometrus thorellii | 8 | 1 | Heterometrus thorellii |
| . . . Heterometrus laevigatus | 5 | 1 | Heterometrus laevigatus |
| . . . Heterometrus glaucus | 2 | 1 | Heterometrus glaucus |
| . . Sahyadrimetrus | 7 | 3 | |
| . . . Sahyadrimetrus kanarensis | 3 | 1 | Sahyadrimetrus kanarensis |
| . . . Sahyadrimetrus scaber | 2 | 1 | Sahyadrimetrus scaber |
| . . . Sahyadrimetrus mathewi | 2 | 1 | Sahyadrimetrus mathewi |
| . . Deccanometrus | 4 | 2 | |
| . . . Deccanometrus bengalensis | 1 | 1 | Deccanometrus bengalensis |
| . . . Deccanometrus xanthopus | 3 | 1 | Deccanometrus xanthopus |
| . . Chersonesometrus | 6 | 4 | |
| . . . Chersonesometrus beccaloniae | 1 | 1 | Chersonesometrus beccaloniae |
| . . . Chersonesometrus tristis | 3 | 1 | Chersonesometrus tristis |
| . . . Chersonesometrus fulvipes | 1 | 1 | Chersonesometrus fulvipes |
| . . . Chersonesometrus madraspatensis | 1 | 1 | Chersonesometrus madraspatensis |
| . . Javanimetrus cyaneus | 4 | 1 | Javanimetrus cyaneus |
| . Pandinus | 3 | 3 | |
| . . Pandinus dictator | 1 | 1 | Pandinus dictator |
| . . Pandinus imperator | 1 | 1 | Pandinus imperator |
| . . Pandinus cavimanus | 1 | 1 | Pandinus cavimanus |
3.2. DNA extraction
Five μg of genomic DNA was extracted from 0.5 g of foot tissue. Using spectrophotometer, the quantity of SmKh1 and SmKh2 samples were estimated to be 650 and 820 nanograms, respectively. To determine the quality of DNA and its contamination with proteins, an absorbance ratio of 260/280 was calculated, which was 1.73. Moreover, its quality was also confirmed by running the DNA extracted on 1% agarose gel.
3.3. Amplification and sequence analysis
During the PCR reaction, a 16srRNA gene fragment of approximately 410 bp was generated. Only 5 μl of the PCR products were taken for agarose gel electrophoresis, indicating the efficient amplification of the target gene and the optimal conditions of the reaction. No amplification product was obtained in the negative control samples where template DNA and enzyme were excluded (Figure 2).
Figure 2. Agarose gel electrophoresis of 16srRNA (SmKh) PCR amplification. Lane M: 100DNA size marker, Line 1 and 2 were negative controls, which lacked DNA and enzyme, respectively. Lane 3: PCR amplification products
After DNA sequencing of the 16srRNA gene fragments by aligning the forward and reverse strands, the complete sequence was determined by finding overlapping regions. In nucleotide sequencing, often about twenty nucleotides at the beginning of each sequenced strand cannot be read due to binding the primers. After trimming and removing the binding site of the primers, two sequences of SmKh1 and SmKh2 were identified with 381 and 380 nucleotides, respectively. The two studied sequences, SmKh1 and SmKh2, were used in the next step for alignment and phylogeny. Two nucleotide sequences obtained from S. maurus specimens named SmKh1 and SmKh2 were compared using Clastal_w program. In this alignment, it was observed that the two sequences are similar with 99.7% similarity and E-Value equal to 6.6e-51. The SmKh1 sequence has an extra T nucleotide at position 63 (Figure 3).
Figure 3. SmKh1 and SmKh2 sequence alignment. The location of an additional T at position 63 of the SmKh1 gene fragment is indicated by an arrow
To compare the nucleotide sequence of SmKh1 and SmKh2 with the sequences available in the Genbank database, the BLASTn program available in the NCBI website was applied using the "Somewhat similar sequences" program. These two sequences showed 100% homology with the only partial sequence of S. maurus isolate SCA1 large subunit ribosomal RNA gene (MW281771).
The nucleotide sequence of SmKh1 and SmKh2 showed similarity with 116 nucleotide sequences from the family Scorpionidae, of which 49 sequences belonged to the genus Scorpio. It was also observed that these sequences are similar to the sequences of 6 species of scorpions, namely S. maurus, S. fuscus, S. kruglovi, S. palmatus, S. propinquus, and S. fuliginosus. It is worth noting that S. palmatus, with 19 sequences has the most similarity in this family, while only three sequences were related to S. maurus species.
3.4. Phylogenetic analysis
The phylogenic tree was drawn using two nucleotide sequence of the 16srRNA gene fragment obtained from S. maurus Behbahan scorpions (SmKh1 and SmKh2). For this purpose, after aligning with similar sequences from the Genbank database, a phylogenetic tree was drawn in comparison with the only two sequences of this scorpion species available in the Genbank database. These two sequences with accession numbers MH170444 and KU705354 were isolated from Miandoab and Mahabad, respectively. The relevant sequences were also retrieved from NCBI GenBank using BLAST program. Then, the studied sequences of S. maurus from Behbahan, along with the related sequences, were aligned using MEGA7 software after sorting in FASTA format. The results showed that the phylogenetic tree has two clusters, A and B (Figure 4). The sequences in these two clusters showed 59% similarity. Cluster A is also divided into two sub-clusters, A1 and A2. In sub-cluster A2, SmKh1 and SmKh2 showed 99% similarity with the only sequence registered in the Genbank, which was also isolated from Behbahan (MW281771). It is noteworthy that the two sequences obtained from S. maurus scorpions recorded from Miandoab (MK170444) and Mahabad (KU705354) which are located in sub-cluster A1, are more similar to the scorpions isolated from the Mediterranean basin (S. kruglovi; KT188203 and S. fuscus; KT188192) than the studied scorpions from Behbahan (SmKh1 and SmKh2). Mesobuthus caucasicus scorpion with accession number AJ83563 was used as out group, which was completely isolated from the rest of the sequences.
Figure 4. Phylogenetic tree of S. maurus scorpions from Behbahan and similar sequences of this species. This tree is based on the sequence of 16srRNA gene fragment using Neighbor -joining analysis. Bootstrap numbers are based on 1050 replicates. The numbers in front of the species are the accession numbers of the related genes in the Genbank. The numbers above the lines indicate the relationship between the groups
Phylogenetic tree of S. maurus scorpions from Behbahan compared to related scorpion sequences showed two clusters, A and B. All sequences of S. maurus scorpion species with SmKh1 and SmKh2 sequences, were placed in cluster B. The two scorpions in this study from Behbahan showed the highest similarity with the only scorpion S. maurus, recorded in the GenBank from Behbahan (MW281771). These three samples had the closest similarity (99%) with scorpions S. Fuliginosus (KT188173), S. Palmatus (KT188207), and S. propinquus (KT188193). While all the scorpions in cluster B belong to the genus Scorpio, there is no scorpion of this genus in cluster A (Figure 5).
Figure 5. Phylogenetic tree of S. maurus scorpions from Behbahan compared to the related scorpion sequences. This tree is based on the sequence of 16srRNA gene fragment using neighbor-joining analysis. Bootstrap numbers are based on 1050 replicates. The numbers next to the branches are the percentage of repetition in the bootstrap test. The numbers in front of the species are the accession numbers of the related genes in the Genbank. The numbers above the lines indicate the relationship between the groups
3.5. Genetic distances
The genetic distance of S. maurus scorpions from Behbahan was compared with the other scorpions of this genus using MEGA7 software. According to Table 2, the percentage of genetic difference between these sequences was estimated between 0.9-7.4%. Since the genetic distance of about 10% between the species has been used as a criterion to confirm the new species ( 15 ), it can be mentioned that all the studied specimens (Smkh1 and Smkh2) are in the same species. The outgroup scorpion specimen (Mesobuthus caucasicus with accession number AJ83563) showed a significant difference with the rest of the specimens (between 36.6-38.4%).
| Specimens | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1. SmKh1(Behbahan) | |||||||||||
| 2.SmKh2(Behbahan) | 0.000 | ||||||||||
| 3.MW281771(S.maurus-Behbahan) | 0.000 | 0.000 | |||||||||
| 4.MK170444(S.maurus-Miandoab) | 0.046 | 0.046 | 0.046 | ||||||||
| 5.KU705354(S.maurus-Mahabad) | 0.046 | 0.046 | 0.046 | 0.009 | |||||||
| 6.KT188192(S.fuscus) | 0.028 | 0.028 | 0.028 | 0.028 | 0.028 | ||||||
| 7.KT188203(S.kruglovi) | 0.037 | 0.037 | 0.037 | 0.028 | 0.028 | 0.019 | |||||
| 8.KT188207(S.palmatus) | 0.046 | 0.046 | 0.046 | 0.046 | 0.046 | 0.037 | 0.046 | ||||
| 9.KT188193(S.propinquus) | 0.051 | 0.051 | 0.051 | 0.037 | 0.037 | 0.032 | 0.042 | 0.028 | |||
| 10.KT188173(S.fuliginosus) | 0.069 | 0.069 | 0.069 | 0.074 | 0.074 | 0.069 | 0.065 | 0.065 | 0.069 | ||
| 11.AJ783563(M.caucasicus) | 0.370 | 0.370 | 0.370 | 0.370 | 0.370 | 0.366 | 0.370 | 0.375 | 0.380 | 0.384 |
4. Discussion
Based on the results, it was shown that SmKh1 and SmKh2 in cluster A2 have the closest relationship (99%) with the only recorded scorpion S. maurus (MW281771) available in the Genbank database, which is also collected from Behbahan. This means that all scorpion specimens in the sub-cluster A2 belong to the species S. maurus. Two S. maurus sequences recorded in the Genbank database from Miandoab (MK170444) and Mahabad (KU705354) were placed under sub-cluster A1 next to S. kruglovi and S. fuscus. Despite some genetic diversity observed among S. maurus scorpion specimens in both sub-cluster A1 and A2, they all belong to the same species. The important point is that the two sequences of S. maurus isolated from Mahabad and Miandoab (sub-cluster A2) were more similar to the scorpions of the Mediterranean basin than to the two specimens studied from Behbahan (SmKh1 and SmKh2). Moreover, the genetic distance results in Table 2 revealed that the genetic difference are between 0-7.4%. Therefore, it can be concluded that the differences among specimens of Scorpio genus in Table 2 are not significant. This issue is probably due to the fact that patterns of genetic diversity often reflect territorial barriers and geographical distances that affect gene flow. In fact, the phenomenon of gene flow and patterns of genetic diversity are mainly applied according to factors such as barriers in the territorial landscape and geographical distances ( 16 ). As can be seen, SmKh1 and SmKh2, were collected from Behbahan, one of the relatively low-altitude and plain areas. These two sequences were slightly different from the sequences obtained from similar scorpion reference from Miandoab (MK170444) and Mahabad (KU705354), which are part of the mountainous regions. In fact, these two reference scorpions have the most genetic similarity to the scorpions of the Mediterranean basin and to a lesser extent to the scorpions collected from Behbahan (Smkh1 and Smkh2), located at a lower altitude. The separation of species occurs due to distance and the occurrence of natural barriers; therefore, the territorial factor is effective on gene flow and genetic diversity that leads to the separation of species. In addition, it has been shown that the different species of scorpions in the genus Scorpio are mainly subspecies, and the differences are generally intra-species ( 2 ). In line with this claim, our results show that not only all the S.maurus scorpions of this study can be placed in one species, but all the Mediterranean scorpions listed in Table 2 can also be placed in the same species, despite the existence of insignificant differences.
We conclude that the scorpions of this study, accompanied with similar scorpions in the Mediterranean basin, belong to the same species despite the insignificant differences.
Authors' Contribution
Study concept and design: A.J and H.J, Acquisition of data: A.J, B.P and H.J, Analysis and interpretation of data: A.J., B.P and H.J, Drafting of the manuscript: A.J and H.J, Statistical analysis: A. J, B.P and H. J.
Administrative, technical, and material support: A.J, B.P and H.J
Ethis
We hereby declare all ethical standards have been respected in preparation of the submitted article.
Conflict of Interest
The authors declare that they have no conflict of interest
References
- Fet V, Sissom WD, Lowe G, Braunwalder ME. atalog of the scorpions of the world (1758–1998). New York: New York Entomological Society; 2000.
- Birula AA. Miscellanea scorpiologica. IX. Ein Beiträg zur Kenntnis der Skorpionenfauna des Russischen Reiches und der angrenzenden Länder. Annuaire du Musée Zoologique de l´Académie Impériale des Sciences de St.-Pétersbourg. 1911; 16: 161-179.
- Gantenbein B, Fet V, Gromov AV. The first DNA phylogeny of four species of Mesobuthus (Scorpiones, Buthidae) from Eurasia. J. Arachnol. 2003; 31(3):412-420.
- Parmakelis A, Stathi I, Spanos L, Louis C, Mylonas M. Phylogeography of Iurus dufoureius (Brulle, 1832) (Scorpiones, Iuridae). J. Biogeogr. 2006; 33(2):251-260.
- Fet V, Soleglad ME. High-level systematics and phylogeny of the extant scorpions (Scorpiones: Orthosterni). Euscorpius. 2003; 11:1-56.
- Woese CR, Fox GE. Phylogenetic structure of the prokaryotic domain: the primary kingdoms. Proceedings of the National Academy of Sciences. 1977; 74(11):5088-5090.
- Abdel-Nabi IM, McVean A, Abdel-Rahman MA, Omran MA. Intraspecific diversity of morphological characters of the burrowing scorpion Scorpio maurus palmatus (Ehrenberg, 1828) in Egypt (Arachnida: Scorpionida: Scorpionidae). Serket. 2004; 9(2):41-67.
- Koc H, Sipahi H, Yagmur EA. Genetic diversity within Scorpio maurus (Scorpiones: Scorpionidae) from Turkey. North-West. J. Zool. 2017; 13(1):27-33.
- Froufe E, Sousa P, Alves PC, Harris DJ. Genetic diversity within Scorpio maurus (Scorpiones: Scorpionidae) from Morocco: Preliminary evidence based on CO1 mitochondrial DNA sequences. Biologia. 2008; 63(6):1157-1160.
- Soltan-Alinejad P, Rafinejad J, Dabiri F, Onorati P, Terenius O, Chavshin AR. Molecular analysis of the mitochondrial markers COI, 12S rDNA and 16S rDNA for six species of Iranian scorpions. BMC. Res. Notes. 2021; 14:40.
- Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994; 22(22):4673-80.
- Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular evolutionary genetics analysis Version 6.0. Mol. Biol. Evol. 2013; 30:2725-2729.
- Vachon M. Etude des caracteres utilises pour classer les familles et les genres de Scorpions (Arachnides). 1. La trichobothriotaxie en arachnologie. Sigles trichobothriaux et types de trichobothriotaxie chez les scorpions. Bulletin du Museum National d’Histoire Naturelle. 1974; 3:857-958.
- Lamoral BH. The scorpions of Namibia. Ann. Natal Mus. 1979; 23:497-784.
- Quijano-Ravell AF, De Armas LF, Francke OF, Ponce-Saavedra J. A new species of the genus Centruroides Marx (Scorpiones, Buthidae) from western Michoacán State, Mexico using molecular andmorphological evidence. ZooKeys. 2019; 859:31-48.
- Wang IJ, Summers K. Genetic structure is correlated with phenotypic divergence rather than geographic isolation in the highly polymorphic strawberry poison-dart frog. Mol. Ecol 2010; 19:447-458.
)
