Molecular Analysis of Virulence Genes HpmB and rsbA among proteus Species Isolated from Different Infectious Cases in Iraq

Introduction

Proteus is a considerable threat to animals and humans around the world. It may be found in various foods and animal sources ( 1 ). This bacterium has several resistant variants, indicating a major food hazard ( 2 ). Control strategies and preventive measures are essential to avoid and combat the outbreaks of forborne diseases from chicken, given the numerous outbreaks of infectious diseases linked to the Proteus set of bacteria and the growing likelihood of Proteus-related contaminated food ( 3 ). Proteus, a member of the Enterobacteriaceae family, was recognized for perhaps the first time by Hauser in 1885. It belongs to the family Proteaceae, which also includes the genera Providencia and Morganella ( 4 ). The gram-negative, motile, aerobic, rod-shaped bacteria seen in Proteus spp. range in size from 0.3 to 1.0 m in width and 0.6 to 6.0 m in length ( 5 ). P. vulgaris, P. mirabilis, P. hauseri, P. myxofaciens, and P. penneri are the five species that belong to the genus Proteus ( 6 ). One of the most critical factors of virulence possessed by this type of germs is the phenomenon of swarming, which is expressed as the movement of bacterial cells in the form of waves. This movement helps in spreading through diffusion in the urinary tract in cases of injury. Other urinary tracts are among the factors of virulence in these bacteria. The proteolytic enzyme UTIs works to break down the peptide bonds of proteases in the protein, which link the amino acids and have several classes and thiol proteases ( 7 ). Most of the metalloprotease isolates of these bacteria are also characterized by their ability to adhere ( 6 ). Hemolysin isolates, which break down red blood cells, are produced by this bacterium. Hemolysis does not stop at the lysis of red blood cells, but in some species (spp.), it works on the analysis of lymphocytes and can stop the process of phagocytosis, as well as the chemical attraction of neutrophil cells ( 8 ). The sensitivity of Proteus spp. is influenced by several factors, all of which have been controlled and expressed via virulence genes transcribed in operons ( 7 ). These pathogenic genes increase the virulence of Proteus spp., such as urease, the most important enzyme in the creation of kidney and bladder stones ( 4 , 9 ), and allow it to thrive ( 10 ). The luxS gene is involved in making autoinducer 2 ( 8 , 10 , 11 ), a bacterial protein that is used to convey cell density and metabolic potential. P. mirabilis swarming behavior is governed by the rsbA gene, which has been connected to biofilm generation and extracellular polysaccharide creation ( 12 ). Regular monitoring of chicken farms is required to determine the likely region of microbiological infections that have spread into the food supply. Urease is so important in P. mirabilis virulence. The urease operon transcript is effectively stimulated by ureR, a dimer of unique 293 amino acid polypeptides that bind urease, causing the protein to bind strongly to ureR and ureD promoters. The ureR then activates RNA polymerase, causing transcription to begin. The goal of this study was to use Polymerase Chain Reaction (PCR) to determine the identification of Proteus-linked virulence genes ( 13 ).

2. Materials and Methods

2.1. Sampling

From April to August 2021, 50 samples were collected from patients at Al-Hussies, Al-Muthanna, and Karbala hospitals. Wounds, ears, and sputum swab samples were collected from patients whose identities were confirmed by doctors. The samples were immediately streaked over blood agar and MacConkey agar and incubated at 37°C for 24 h.

2.2. First Diagnostic Step

The isolates were recognized visually and biochemically. They were first identified based on the shape of the colonies on the MacConkey medium and blood agar, as well as the observation of the swarming phenomenon. Since a Gram stain was applied, they were also diagnosed based on morphological traits under a microscope ( 9 ).

2.3. Molecular Detection

The extraction of DNA was conducted using an EasyPure^® Bacteria Genomic DNA Kit (TransGen Biotech, China), according to the manufacturer’s instructions. The DNA was extracted from culture media that contained suspended bacterial cells. The PCR was used to examine the virulence genes of Proteus spp. The primer sets (5' TTGAAGGACGCGATCAGACC3') and (3' ACTCTGCTGTCCTGTGGGTA5') were used to amplify a 467-bp sequence of the rsbA gene, and (5' CAGTGGATTAAGCGCAAATG-3') and (5' CCTTCAATACGTTCAACAAACC-3') were used to amplify a 422-bp sequence of the hpmB gene. The primers were prepared by dissolving the lyophilized primers in the TE (Tris-EDTA) buffer to create a stock solution containing 100 mmole/mL, as directed by the manufacturer. The working solution for each primer was created by diluting the stock solution with TE buffer to obtain the final working solution (10 mmole/mL) after spinning it down. It was reserved overnight at 4°C. The PCR master mix reaction was performed using a OneTaq^® Quick-Load PCR kit (New England Biolabs, USA), according to the manufacturer’s instructions, as shown in table 1.

Following that, the previously mentioned PCR master mix component was inserted in the PCR tubes containing the multiplex PCR while the lyophilized materials contained all other PCR reaction components, such as Taq DNA polymerase, dNTPs, and 6 mM MgCl₂, with a pH of 8.7. The tube was centrifuged for 3 min in an ExiSpin vortex centrifuge (Bioneer, South Korea). It was then transferred to a multigene PCR thermocycler to be processed further. Table 2 displays the PCR thermocycler parameters for each gene when using a standard PCR thermocycler setup. Three samples were sequenced using PCR by the Macrogen Company in South Korea. Nucleotide substitutions were discovered by matching data from the GenBank publications available at the NCBI (). The results were registered in the NCBI under the registration number (LC661938), which is available on the website ().

3. Results

3.1. Identification of Proteus spp.

Fifty samples were collected from patients’ wounds, ears, and sputum. Clinicians collected swab samples for identification. In total, 27 (54%) females and 23 (46%) males provided 17 sputum samples, 13 ear samples, and 20 wound samples. Table 3 shows that 16 isolates were obtained using the rsbA primer and 13 using the hpmB primer.

The DNA was extracted from culture media containing suspended bacterial cells using an EasyPure^® Bacteria Genomic DNA Kit (TransGen Biotech, China). It was then identified using agarose gel electrophoresis, as shown in figure 1A. The results were identified using 1% agarose electrophoresis and UV light exposure, indicating that all isolates produce the same result for biochemical diagnosis, regardless of the primer type. The PCR products of rsbA and hpmB primers showed 467 bp at 55°C and 422 bp at 55°C, respectively, after being optimized by gel electrophoresis with different temperatures and primers (Figure1B). The virulence genes hpmB and rsbA were identified through the molecular investigation of Proteus spp., as shown in figure 2A and 2B).

Figure 1.(a) Depicts an ethidium bromide-stained agarose gel electrophoresis appearance displaying DNA extracted from bacteria. (b) Gel electrophoresis for optimization process with different temperatures and different Pimers for PCR product of rsbA and HpmB primer which shows (467bp at 55°C and 422bp at 55°C) respectively (Agarose 1%, 10 min at 100 voltage and then lowered to 70 volts, 60 min). Lane L: 100-1500 bp DNA ladder

Figure 2.(a) Gel electrophoresis for the PCR product of the rsbA primer, which shows 467 bp at 55 °C (agarose 1%, 10 min at 100 volts, and then lowered to 70 volts, 60 min.) visualized under UV light after staining with ethidium bromide. Lane L: DNA ladder (1500-100) bp; Lanes 3, 5, 7, 8, 13, 17, 19, 20, 24, 27, 29, 32, 34, 35, 43, and 46: positive results; Lane N: negative control. (b) Gel lectrophoresis for PCR product of (HpmB primer) which shows 422bp Primer TM at (55C), (Agarose 1%, 10min.at 100 voltage and then lowered to 70 volts, 60 min). Visualized under U. V light after staining with ethidium bromide Lane L: DNA ladder (1500-100)bp , Lanes (3, 7, 8,13,19, 20, 24, 27, 29, 35, 43 and 46) represented positive results, Lane (N) represented Negative control

3.2. DNA Sequence Analysis of rsbA Gene

Three samples were sequenced using PCR sequences by the Macrogen Company in South Korea. The findings were submitted to the NCBI under the accession number LC661938 and can be found at the following link: Sample 1 had 99.52% identity when rsbA was matched to the genes with Sequence ID CP053684.1. Compared to the same genes in the CP053718.1, sample 2 had 99.52% identity for rsbA, while sample 3 had 99.52% identity for rsbA when matched to the same genes in the CP045257.1. Based on our results, the rsbA gene sequence analysis revealed three polymorphisms in the rsbA gene in sample 1. There was a nucleotide deletion at loci 2944607, 2944613, and 2944640. The rsbA gene sequence analysis also revealed two polymorphisms in the rsbA gene in sample 2. A nucleotide deletion was discovered at loci 1592842 and 1592869. The rsbA gene sequence analysis in sample 3 revealed two changes in the gene. A nucleotide deletion was discovered at locus 2461454, while a nucleotide insertion was discovered at locus 2461481. However, as shown in table 4, impact variation altered the sequence of amino acids in the protein, changing its function or causing the protein produced by the gene not to function normally.

3.3. DNA Sequence Analysis of hpmB Gene

Macrogen Company in South Korea sequenced the three samples using PCR sequences. Nucleotide variations were measured by analyzing data from the GenBank publications, which are accessible at the NCBI (). The results were registered in the NCBI under the accession number (LC661938), which can be found on the website (). Sample 1 had 99.20% identity for hpmB when matched to the genes with Sequence ID CP053683.1. Sample 2 had 99.95% identity for hpmB, compared to the same genes in CP053719.1, and sample 3 had 99.21% identity for hpmB, compared to the same genes in CP042857. In sample 1, the findings of the hpmB gene sequence analysis revealed three polymorphisms, as shown in table 2. Nucleotide deletion was discovered at loci 322785, 322793, and 322811. There were four polymorphisms in the hpmB gene in sample 2. Nucleotide deletion was discovered at loci 248428, 248436, and 248454. Nucleotide deletion and insertion were discovered at locus 248739. There were also three polymorphisms in the hpmB gene in sample 3. Nucleotide deletions were discovered at loci 281114 and 281112. A nucleotide deletion was also discovered at locus 2811140. However, as shown in table 5, effect variation caused a change in the sequence of amino acids in the protein, which alters the protein’s function or causes the protein produced by the gene to malfunction.

3.4. DNA Sequence Analysis of rsbA and hpmB Genes

A phylogenetic tree is a subset of phylogeny that examines hereditary molecular distinctions, primarily in DNA sequences, to determine an organism’s evolutionary relationships based on the rsbA gene. A specialized genotyping technology can identify any microorganism’s genetic profile, which is as unique as a fingerprint ( 9 ). Phylogenies derived from a single gene, on the other hand, should be treated with caution ( 7 ). Figure 3 shows a phylogenetic tree built from rsbA gene sequences from three clinical strains of P. mirabilis samples with varying sequences available at the NCBI.

Figure 3. Phylogenetic tree of Proteus species based on rsbA gene sequence analysis.

P. mirabilis (LC661938) is closely related to P. mirabilis (CP045257.1, CP053684.1, and CP053718.1). Figure 4 shows a phylogenetic tree built from hpmB gene sequences of three clinical strains of P. mirabilis samples and other NCBI sequences, demonstrating that P. mirabilis (LC661939) is related to P. mirabilis (CP053683.1, CP053719.1, and CP042857. 1). Because they contain a high conservation region that differs between spp., 1.5 kb 16S rRNA sequences have been recognized and widely used in bacterial taxonomy. The rsbA gene was discovered to be an effective and acceptable molecular marker for P. mirabilis differentiation, which has the potential to be used as an effective molecular tool for determining P. mirabilis phylogenetic relationships, as well as a powerful tool for investigating numerous microorganisms. Understanding the regulatory and metabolic structure that connects chromosomal genes requires a thorough understanding of the genome sequence ( 1 ). The rsbA gene sequence was used as a molecular clock in our study to assess bacterial relationships (phylogeny). The combination of molecular phylogeny with traditional methods, such as morphology, physiology, and biochemistry, could improve bacterial identification ( 14 ).

Figure 4. Phylogenetic tree of Proteus species based on HpmA gene sequence analysis

4. Discussion

Proteus spp. was found in numerous human sources, with no clinical indications ( 15 ). Because Proteus spp. is an opportunistic infection, healthy turtles can carry the pathogen without becoming ill ( 16 ). In this study, 50 samples were collected from patients’ wounds, ears, and sputum, including 17 from sputum, 13 from ears, and 20 from wounds. They were collected from 27 (54%) females and 23 (46%) males. When grown on blood agar plates, all typical Proteus isolates exhibited swarming motility 100% of the time. Proteus spp. has several distinguishing characteristics within the Enterobacteriaceae family, such as swarming motility, a coordinated multicellular activity involving flagella, occurring when cells begin on solid, rich media or sticky surfaces ( 15 , 17 , 18 ). Antimicrobials, such as aminoglycosides, amikacin, and gentamicin, were the most effective against Proteus spp., with a 95.9% success rate, but tetracycline exhibited the highest resistance (25.7%). According to Omoruyi and Evangelista ( 14 ), Proteus has moderate resistance to amikacin and gentamicin, as well as overall resistance to tetracycline. Proteus spp. resistance to ciprofloxacin was modest (4.1%) in this study, compared to the 36.8% resistance reported by Pearson, Rasko ( 18 ). The isolates’ lower resistance to ciprofloxacin may be attributed to the drug’s small size, which makes it more soluble in diluents and increases its penetration power through the cell into the cytoplasm of the target organism where it acts ( 19 ). There were 25 Proteus isolates discovered. The rsbA gene could not be amplified in P. vulgaris or P. hauseri. However, the majority of positive strains were P. mirabilis, which is consistent with previous research findings ( 20 ). All of the studied isolates had phenotypic characteristics of swarming in wounds and possibly the septum. Due to the large number of genes and operons involved in the process, swarming-regulated genes are not required for swarming ( 8 ). The findings are consistent with previously published studies ( 21 ). It was discovered that all of the isolates produced the urease enzyme. The hpmB gene of P. mirabilis, which produces hemolysin, is thought to be a major virulence factor. A phylogenetic tree is a subset of phylogeny, based on the rsbA gene, which investigates hereditary molecular characteristics, mostly in DNA sequences, to discover an organism’s evolutionary relationships. Specialized genotyping tools can detect the genetic profile of a microorganism, which is as unique as a fingerprint ( 9 ). On the other hand, phylogenies generated from a single gene should be treated with caution ( 7 ). In Harada, Niina ( 22 ), a phylogenetic tree was constructed using rsbA gene sequences from three P. mirabilis clinical strains and other NCBI sequences, demonstrating that P. mirabilis (LC661938) is related to P. mirabilis (LC661938). In Ghebremedhin, Layer ( 8 ), a phylogenetic tree was constructed using HpmB gene sequences from three P. mirabilis clinical strains with different sequences available at the NCBI, demonstrating that P. mirabilis (LC661939) is related to P. mirabilis (LC661939). Because they contain a high conservation section with a variable portion in different species, 16S rRNA sequences with a size of 1.5 kb are assessed and extensively used in taxonomy. The rsbA gene was discovered to be an effective molecular marker for P. mirabilis specialization, which might be utilized as an alternative molecular tool for assessing P. mirabilis genetic relationships, as well as a powerful tool for microorganism research. The genome sequence reveals a great deal about the regulatory and metabolic network that links chromosomal genes ( 1 ). In our study, the sequence of the rsbA gene was used as a molecular clock to assess the relationships between bacteria (phylogeny). The combination of molecular phylogeny with more traditional techniques, such as morphological, physiological, and biochemical characteristics, could lead to better bacterial diagnosis ( 14 ).

Authors' Contribution

Study concept and design: K. M. A.

Acquisition of data: K. M. A.

Analysis and interpretation of data: A. A. M. A.

Drafting of the manuscript: A. A. M. A.

Critical revision of the manuscript for important intellectual content: A. A. M. A.

Statistical analysis: A. A. A.

Administrative, technical, and material support: A. A. A.

Ethics

The study protocol was approved by the ethics committee of the 1. AL Safwa University College, Karbala City – 56001, Iraq.

Conflict of Interest

The authors declare that they have no conflict of interest.

References

1. Back DS, Shin GW, Wendt M, Heo GJ. Prevalence of Salmonella spp. in pet turtles and their environment. Lab Anim Res. 2016; 32(3):166-70.
2. Mohammed SO, Hafez EE, Khalid A, ElShahaby OA. Characterization and purification of urease enzyme from new proteus mirabilis strain. J Adv Sci Res. 2014; 5(04):8-11.
3. Dalia A. Prevalence of Proteus spp. in some hospitals in Baghdad city. Iraqi. J Sci. 2015; 56:665-72.
4. Drzewiecka D. Significance and Roles of Proteus spp. Bacteria in Natural Environments. Microb Ecol. 2016; 72(4):741-58.
5. Hadfield JD, Nakagawa S. General quantitative genetic methods for comparative biology: phylogenies, taxonomies and multi-trait models for continuous and categorical characters. J Evol Biol. 2010; 23(3):494-508.
6. Różalski A, Torzewska A, Moryl M, Iwona K, Agnieszka M, Kinga O, et al. Proteus sp.–an opportunistic bacterial pathogen–classification, swarming growth, clinical significance and virulence factors. Folia Biol Oeco. 2013; 8:1-17.
7. Henriksen P. Diagnosis and treatment of disease in the turtle. 1972.
8. Ghebremedhin B, Layer F, Konig W, Konig B. Genetic classification and distinguishing of Staphylococcus species based on different partial gap, 16S rRNA, hsp60, rpoB, sodA, and tuf gene sequences. J Clin Microbiol. 2008; 46(3):1019-25.
9. Hidalgo-Vila J, Diaz-Paniagua C, de Frutos-Escobar C, Jimenez-Martinez C, Perez-Santigosa N. Salmonella in free living terrestrial and aquatic turtles. Vet Microbiol. 2007; 119(2-4):311-5.
10. Hordijk J, Schoormans A, Kwakernaak M, Duim B, Broens E, Dierikx C, et al. High prevalence of fecal carriage of extended spectrum beta-lactamase/AmpC-producing Enterobacteriaceae in cats and dogs. Front Microbiol. 2013; 4:242.
11. Abdul-Lateef LA. Sequencing of Proteus Toxic Agglutinin (Pta) Gene in Proteus Mirablis and Cytotoxic Effect of Pta on Human Colon Cancer Cell and Human Kidney Cell. J Global Pharma Technol. 2017; 9(9)
12. Heo GJ, Hossain S, Wimalasena S. Virulence factors and antimicrobial resistance pattern of Citrobacter freundii isolated from healthy pet turtles and their environment. Asi J AniVet Adv. 2016; 12(3):221.
13. Walker KE, Moghaddame-Jafari S, Lockatell CV, Johnson D, Belas R. ZapA, the IgA-degrading metalloprotease of Proteus mirabilis, is a virulence factor expressed specifically in swarmer cells. Mol Microbiol. 1999; 32(4):825-36.
14. Omoruyi EA, Evangelista M. Proteus mirabilis septicemia and meningitis in a neonate. J Med Cases. 2014; 5(4):245-7.
15. Li X, Mobley HL. Vaccines for Proteus mirabilis in urinary tract infection. Int J Antimicrob Agents. 2002; 19(6):461-5.
16. Manos J, Belas R. The Prokaryotes: A Handbook on the Biology of Bacteria Volume 6: Proteobacteria: Gamma Subclass. Springer New York: New York, NY; 2006.
17. Barbour EK, Hajj ZG, Hamadeh S, Shaib HA, Farran MT, Araj G, et al. Comparison of phenotypic and virulence genes characteristics in human and chicken isolates of Proteus mirabilis. Pathog Glob Health. 2012; 106(6):352-7.
18. Pearson MM, Rasko DA, Smith SN, Mobley HL. Transcriptome of swarming Proteus mirabilis. Infect Immun. 2010; 78(6):2834-45.
19. Ma R, Wu X, Wang R, Wang C, Zhu J. Identification and phylogenetic analysis of a bacterium isolated from the cloaca of Chinese alligator. Afr J Biotechnol. 2008; 7(13)
20. Rocha SP, Elias WP, Cianciarullo AM, Menezes MA, Nara JM, Piazza RM, et al. Aggregative adherence of uropathogenic Proteus mirabilis to cultured epithelial cells. FEMS Immunol Med Microbiol. 2007; 51(2):319-26.
21. Senior BW. Media and tests to simplify the recognition and identification of members of the Proteeae. J Med Microbiol. 1997; 46(1):39-44.
22. Harada K, Niina A, Shimizu T, Mukai Y, Kuwajima K, Miyamoto T, et al. Phenotypic and molecular characterization of antimicrobial resistance in Proteus mirabilis isolates from dogs. J Med Microbiol. 2014; 63(11):1561-7.