Upregulation of XRCC1 DNA Repair Gene, Interleukin-8, and Bcl-2 Antiapoptotic Gene Levels in Kurdish Patients with Gastric Adenocarcinoma

1. Introduction

Globally, gastric cancer (GC) is the fifth foremost common cancer and the third prominent cause of death due to cancer ( 1 ). According to GLOBOCAN 2018 reports, it is the fourth cancer type in males and the seventh in females ( 2 ). Currently, inadequate data are available regarding the newest incidence of cancer, including GC in the Kurdistan region of Iraq. According to recent research conducted in Kurdistan, GC is the seventh greatest form of cancer, predominantly diagnosed amongst elderly patients (≥90 years old). Moreover, it has been reported that GC is most frequently diagnosed in the late stage, compared to the other types of cancer ( 3 ).

Chronic infection with Helicobacter pylori is the most prominent and evitable cause of GC, especially the non-cardia gastric carcinoma type, which resulted in an estimated 800,000 new GC cases worldwide in 2018 ( 4 ). Following the international agency and World Health Organization study, H. pylori has been selected as a class I carcinogen. Other factors, such as smoking habits, diet, family history, and alcohol, are considered risk factors for GC ( 5 ).

There are various genes involved in GC pathogenesis. The alterations in genes, such as DNA repair genes (XRCC1), might contribute to GC progression. The importance of DNA repair systems is retaining human genome integrity via various pathways that protect against DNA damage ( 6 ). Interleukin-8 (IL-8) is a predominant tumorigenic cytokine that participates in chronic inflammation and GC development. The IL-8 and its receptors play a fundamental role in the expansion and metastasis of the human stomach ( 7 ). The elevated level of IL-8 in human stomach cancer appears to be involved in the intimate angiogenesis process ( 8 ).

The B-cell lymphoma 2 (BCl-2) family has long been identified for its role in apoptosis. The BCL-2 is one of the most vital oncogenes involved in cancer by hindering apoptosis and causing the progress of the malignant disease ( 9 ). The mechanism of antiapoptotic BCL-2 is through impeding the mitochondrial pathway and communication with other associates of the BCL-2 lineage that leads to cell survival ( 10 ).

Although there are different treatments available, GC incidence and mortality have not decreased or stabilized yet. Therefore, researchers are interested in investigating the alteration in the level of genes that might be associated with GC development and progression. In this regard, the vital objective of this research was to find out the expression degree of cytokine IL-8, DNA repair gene (XRCC1), and antiapoptotic gene (BCL-2) in gastric adenocarcinoma in the Kurdish people in the Kurdistan Region of Iraq.

2. Materials and Methods

2.1. Patients and Samples

In total, 110 tissues from gastric patients were collected from November 2021 until June 2022. About 66 samples were freshly collected, including 6 resected GC tissue, biopsies from 12 patients with gastric inflammation, 4 polyps, 1 ulcer, and 43 normal gastric patients. The samples were collected and histologically confirmed at various hospitals in the Kurdistan region of Iraq, including Erbil City (Par, CMC hospital, Teaching Hospital Rezgary) and Sulaymaniyah (High-quality Anwar medical city and Smart hospital). Furthermore, 44 frozen tissue samples (23 resected gastric tissue and 21 normal gastric biopsies) were collected from Sulaymaniyah Hospital. However, the histopathological data were incomplete and, in some cases, unavailable. The tissue samples were sliced into small quantities and frozen in 10x PBS solution, then stored at -80 °C in a deep freezer at the scientific research center, Erbil Polytechnic University, until RNA extraction.

2.2. Quantitative Real-Time ​Polymerase Chain Reaction

Total RNA was purified from the gastric tissues of patients following the protocol of the manufacturer using a total RNA mini kit (Geneaid, Korea). The concentration and the purity of total RNA were estimated using a NanoDrop instrument (Thermo Scientific, USA). The integrity of total RNA was assessed by performing agarose gel electrophoresis. The agarose gel solution was prepared from powder agarose (Bio Tek, Canada) and dissolved in 1x Tris-borate-EDTA buffer (GeNet Bio, Korea). Eventually, the samples were loaded, and the gel electrophoresis system was initiated at 100 V, 75 mA for 60 min. The results were viewed using a gel documentation system (Biotech-Fischer, Germany).

For better RT-PCR reaction, the total RNA was treated with DNase I to remove possible DNA contamination using a DNase kit (Yekta Tejhiz, Iran) following the instructions of the manufacturer. After that, quantitative RT-PCR was carried out in a two-step process. The RNA was transcribed reversely into cDNA using the High-Capacity cDNA Reverse Transcription (RT) kit (Add Bio, Korea), and then qRT-PCR was performed using the SYBER® Green Master mix kit (Amplicon Real Q, Denmark) according to the procedure suggested by the manufacturer. Hereafter, the required components of the mixture were added, the prepared solution was placed into a PCR instrument, and the temperature cycling protocol was used based on the protocol provided by the manufacturer. The cycling temperature consisted of priming at 25 °C for 10 min, RT at 50 °C for 60 min, RT inactivation at 80 °C for 5 min, and holding at 12 °C for 2 min. Consequently, the prepared cDNA is ready for RT-PCR.

The transcript levels of three different target genes (XRCC1, IL-8, and BCL-2) were assessed by operating the reactions in a BIO-RAD^® MJ Mini cycler, PTC-0148 & CFD-3120 MINI OPTICON qRT-PCR^TM system. A total reaction mixture of 25 μl was prepared by the addition of 5 μl of SYBER Green master mix (Denmark, Amplicon RealQ master mix green), 0.3 μl of each forward and reverse specific primers that are designed for each gene, 1,4 μl of ddH2O, and 3 μl of cDNA. A two-step qPCR method was used to amplify the target genes. All primers were designed by using GENERUNNER software (version 4) and are as follows: XRCC1, (F) ‘CCAACCCCTGAAGAGACCAA’, (R), ‘TGTTCCTCACTGTCCGTGT’. IL-8, (F), ‘CGGGAGAATATACAAATAGCAA’, (R), ‘TAAAGGAGAAACCAAGGCAC’. BCL-2, (F) ‘CTGTGGATGACTGAGTACCTG’, (R), ‘ACAGCCAGGAGAAATCAAACA’, β-actin, (F), ‘5-CAGCACCTTGCCCCAAAATC -3’, (R), ‘5-TGGATGGCAAACCTCAGCTC-3’.

2.3. Statistical Analysis

The correlations among gender, age, and clinical characteristics of gastric patients were evaluated in Software Prism 9 (GraphPad Software) using chi-squared and Fisher’s exact test. The results were expressed as mean values. Statistical analysis was applied in SPSS software (version 21.0) to determine differences in gene expression. The *, **, and *** indicate statistically significant P values of < 0.05, < 0.01, and < 0.001, respectively.

3. Results

3.1. Gender, Age, and Clinical Characteristics of Gastric Patients

Only the gender, age, and some clinical data of the 66 gastric patients were analyzed due to the available information about their characteristics. It appeared that 28 (42%) out of the total 66 patients were female with an age range of 19-89 years old (average: 36.7±15.3). Furthermore, the males constituted 38 (58%) of the gastric patients with an age range of 16-78 years old (average: 45.6±16.7).

3.2. Distribution of Helicobacter pylori Infection Regarding Age, Gender, and Diagnosis

In this study, the patients who tested positive for H. pylori were equally distributed (50%) in terms of gender, while in the H. Pylori negative group, the females were prominent (58%). Figure 1 demonstrates that H. pylori-positive cases are highest (5%) in the age groups of 30-45 and 45-60 years, while the percentage of positively tested patients drops to 3% in the younger age groups. However, patients older than 60 years old tested negative for H. Pylori infection (100%).

Figure 1. Distribution of H. pylori infection in different age groups. Most patients in the different age groups are H. pylori-negative, and in the age groups 30-60 years, most H. pylori infections are detected

Furthermore, figure 2 illustrates that all regular gastric patients and all gastric cancer patients tested negative for H. pylori, while most of the H. pylori infections were found in the gastric inflammation group (11%) followed by gastric ulcer (1%) and gastric polyp (1%).

Figure 2.H. pylori test distribution according to patients’ diagnosis. All regular diagnosed gastric patients and gastric cancer negative tested for H. pylori. The gastric inflammation group found the highest number of H. pylori positively tested patients

3.3. Assessment of Quality of Total RNA in Different Samples

To determine the quality of the extracted RNA from the gastric tissues, 1.5% gel electrophoresis was used for two samples, as shown in figure 3. It demonstrated that the 18s rRNA was visible as bright bands followed by 28s rRNA in gastric tumor tissue. This result was similar to that of the positive control samples, indicating a good RNA quality that can be used for further molecular experiments, such as cDNA synthesis from RNA.

Figure 3. Agarose gel illustrates the quality of extracted total RNA from GC patient tissues. The two visible bands in lanes 1 and 2 imply a good RNA quality. Lane 1: positive control, lane 2: gastric tumor, lane 3: Marker. Total RNA is visible as bright bands in a 1,5% agarose gel, implying a proper quality of the total RNA

3.4. Quality Assessment of cDNA of the Target Genes

To measure the expression level of target genes, first, the total RNA from GC tissues was reversely transcribed into cDNA using a specific two-step kit and qRT-PCR. After cDNA synthesis, the quality of cDNA was confirmed using 1.5% gel electrophoresis. It was found that all three target genes showed a bright band with different sizes (IL-8: 251 bp, XRCC1: 230 bp, and Bcl-2: 124 bp), meaning that they were detected in the sample of the patients (Figure 4). Moreover, an internal control B2m with 191 bp was used to determine the quality of the cDNA reaction and all the visible bands were compared with the marker to determine the size of the bands.

Figure 4. Quality assessment of cDNA of the target genes. The visible bright bands show different band sizes for each specific gene. Lane 1: Marker, Lane 2: internal control B2m amplicon (191bp), lane 3: IL-8 (251bp), lane 4 XRCC1 (230bp), and Lane 5 Bcl-2 (124bp)

3.5. Gastric Cancer-Related Gene Expression

The relative expression of target genes in the GS patients was compared to that in the healthy control patients using the qRT-PCR assay to find out the alteration in the expression level of target genes. Figure 5 illustrates the relative expression of three different target genes. It is exhibited that the level of the DNA repair gene (XRCC1) is significantly (P<0.05) elevated in GC tissues, compared to the normal tissues (Figure 5A). Furthermore, the level of proinflammatory cytokines IL-8 underwent a highly significant (P<0.01) increase in GC patients in comparison with the control group (Figure 5B). Regarding the antiapoptotic gene BCL-2, there was an obvious upregulation of the BCL-2 gene in GC, while the relative expression was significantly (P<0.001) reduced in the control group (Figure 5C).

Figure 5. The relative expression of gastric cancer-related genes was measured by using the RT-PCR technique. The relative expression is significantly increased in the genes of GC patients (A) XRCC1 gene, (B) highly significant IL-8 gene, and (C) and highly significant BCL-2 gene. The *, **, and *** indicates statistically significant P < 0.05, P < 0.01, P < 0.001, respectively

4. Discussion

Gastric cancer is a highly prevalent cancer that originates from the lining of the stomach and is usually identified at a progressed stage, as it manifests late phase of the disease and does not show any signs and symptoms ( 11 ). In total, 66 patients with complete available clinical data were used for correlation analysis. The H. pylori positive test was equally divided between both genders. This is in contrast with the findings of a study performed by Soward ( 12 ) Sowaid, Ali ( 12 ) Sowaid, Ali ( 12 ) which showed that gastric male patients were more frequently infected with H. pylori than gastric female patients. The small size of collected patient data due to incomplete available clinical data was probably the cause of this discrepancy. Based on the results, there was a higher percentage of H. pylori in the group of patients within the age range of 30-60 years old, which was in line with the findings of a previous study performed by Yang, Kartsonaki ( 13 ).

In the present study, 29 out of 110 human gastric tissue samples were confirmed as GC tissue and used to assess the relative expression level of three different target genes, including XRCC1, IL-8, and BCL-2, by qRT-PCR. There are several genes involved in the growth and development of GC. One of the important members of the DNA repair gene is the XRCC1 protein which cooperates with numerous DNA repair-related proteins to complete DNA ( 14 ). The present study showed a significant elevation in the level of the XRCC1 gene in GC patients, compared to the control group. This result contrasts with those of the study conducted by Wang, Tang ( 14 ), which found downregulation in the XRCC1 gene expression and claimed that XRCC1 promotes gastric carcinogenesis. Researchers have suggested that CRCC1 might be used as a biomarker to predict GC recurrence. However, limited data are available regarding the upregulation of XRCC1 in gastric cancer ( 15 ).

Cancer is a multifactorial process that occurs in response to tissue damage or infection whereby different proinflammatory cytokine, including IL-8, is secreted by activated macrophages that initiate inflammation ( 16 ). It has been stated that IL-8 is a critical regulatory component in the tumor microenvironment ( 17 ). Results of the present research showed the upregulation of the IL-8 gene in GC patients. This result reflects those of a study carried out by Lee, Khoi ( 8 ), who also revealed elevated levels of IL-8 in GC patients and suggested the involvement of IL-8 in GC invasion and metastasis. Moreover, another group of researchers has found that the high expression of IL-8 was an independent risk factor for causing GC prognosis ( 15 ), while other investigators have astumor gastric cancer ( 16 , 18 , 19 ).

Alteration in the apoptosis proteins is one of the critical factors in the development of many cancers, including GC. Findings of the current study indicated significant upregulation of the Bcl-2 gene level, compared to the control group. This finding is similar to those of the research group of Xu, Li ( 20 ), which demonstrated significantly high expression of antiapoptotic Bcl-2 in GC and claimed that Bcl-2 is involved in early GC development.

In conclusion, this study revealed a significant upregulation of the target genes XRCC1, IL-8, and BCL-2 in Kurdish gastric cancer patients. These genes might play a role in the GC progression; therefore, targeting these specific genes might be an exciting and promising strategy for the treatment of GC.

Authors' Contribution

Study concept and design: Z. H.

Analysis and interpretation of data: D. A. K. and Z. H.

Drafting of the manuscript: D. A. K.

Critical revision of the manuscript for important intellectual content: Z. H.

Statistical analysis: D. A. K. and Z. H.

Study supervision: N. F. S. A. and Z. H.

Ethics

This study was approved by the Human Ethics Committee of Technical Health and Medical College, Polytechnic University, Erbil, Iraq.

Conflict of Interest

The authors declare that they have no conflict of interest.

Grant Support

The authors received no financial support for this research, authorship, and/or publication.

Acknowledgment

The authors would like to thank Dr. Goran Othman from Technical Health and Medical College for his help and guidance in this study, Dr. Hemn from High-quality Anwar Medical City, and Dr. Mohammed Niyazi from Par Hospital for sample collection.

References

1. Rawla P, Barsouk A. Epidemiology of gastric cancer: global trends, risk factors and prevention. Prz Gastroenterol. 2019; 14(1):26-38.
2. Thrift AP, El-Serag HB. Burden of gastric cancer. Clin Gastroenterol Hepatol. 2020; 18(3):534-42.
3. Karwan M, Abdullah OS, Amin AM, Mohamed ZA, Bestoon B, Shekha M, et al. Cancer Incidence in the Kurdistan Region of Iraq: Results of a Seven-Year Cancer Registration in Erbil and Duhok Governorates. Asian Pac J Cancer Prev. 2022; 23(2):601.
4. Rawla P, Barsouk A. Epidemiology of gastric cancer: global trends, risk factors and prevention. Prz Gastroenterol. 2019; 14(1):26-38.
5. Ford AC, Yuan Y, Forman D, Hunt R, Moayyedi P. Helicobacter pylori eradication for the prevention of gastric neoplasia. Cochrane Database Syst Rev.
6. Asgerov E, Şenol Ö, Güler A, Berdeli A. Distribution of nucleotide variants in the DNA sequence of ERCC1 and XRCC1 genes and the effect of phenotype in patients with gastric cancer. Turk J Gastroenterol. 2019; 30(6):517.
7. Bie Y, Ge W, Yang Z, Cheng X, Zhao Z, Li S, et al. The crucial role of CXCL8 and its receptors in colorectal liver metastasis. Dis Markers. 2019; 2019
8. Lee KE, Khoi PN, Xia Y, Park JS, Joo YE, Kim KK, et al. Helicobacter pylori and interleukin-8 in gastric cancer. World J Gastroenterol. 2013; 19(45):8192.
9. Strasser A, Harris AW, Bath ML, Cory S. Novel primitive lymphoid tumours induced in transgenic mice by cooperation between myc and bcl-2. Nature. 1990; 348(6299):331-3.
10. Lee JH, Soung YH, Lee JW, Park WS, Kim SY, Cho YG, et al. Inactivating mutation of the pro‐apoptotic gene BID in gastric cancer. J Pathol. 2004; 202(4):439-45.
11. Yeni M, Korkut E, Aksungur N, Kara S, Askin S, Kartal M. Determination of Pentraxin-3, Interleukin-8 and vascular endothelial growth factor levels in patients with gastric adenocarcinoma. Asian Pac J Cancer Prev. 2021; 22(5):1507.
12. Izaldeen Sowaid Y, Ali OM, Saad Abul Hussian S. Extra-Gastroduodenal Manifestation and Helicobacter pylori Infection. Arch Razi Inst. 2022; 77(3):1017-26.
13. Yang L, Kartsonaki C, Yao P, de Martel C, Plummer M, Chapman D, et al. The relative and attributable risks of cardia and non-cardia gastric cancer associated with Helicobacter pylori infection in China: a case-cohort study. Lancet Public Health. 2021; 6(12):e888-e96.
14. Wang P, Tang JT, Peng YS, Chen XY, Zhang YJ, Fang JY. XRCC1 downregulated through promoter hypermethylation is involved in human gastric carcinogenesis. J Dig Dis. 2010; 11(6):343-51.
15. Wang W, Yang J, Yu Y, Deng J, Zhang H, Yao Q, et al. Expression of JWA and XRCC1 as prognostic markers for gastric cancer recurrence. Int J Clin Exp Pathol. 2020; 13(12):3120.
16. Li J, Xu L, Run Z-C, Feng W, Liu W, Zhang P-J, et al. Multiple cytokine profiling in serum for early detection of gastric cancer. World J Gastroenterol. 2018; 24(21):2269.
17. Campbell LM, Maxwell PJ, Waugh DJ. Rationale and means to target pro-inflammatory interleukin-8 (CXCL8) signaling in cancer. Pharmaceuticals. 2013; 6(8):929-59.
18. Shi J, Li Y-J, Yan B, Wei P-K. Interleukin-8: A potent promoter of human lymphatic endothelial cell growth in gastric cancer. Oncol Rep. 2015; 33(6):2703-10.
19. Sun X, Xiang CJ, Wu J, Dong W, Zhan Z, Wang RP, et al. Relationship between serum inflammatory cytokines and lifestyle factors in gastric cancer. Mol Clin Oncol. 2019; 10(3):401-14.
20. Xu A-G, Li S-G, Liu J-H, Gan A-H. Function of apoptosis and expression of the proteins Bcl-2, p53 and C-myc in the development of gastric cancer. World J Gastroenterol. 2001; 7(3):403.