Molecular Detection and Phylogenetic Analysis of Pseudomonas aeruginosa Isolated from Some Infected and Healthy Ruminants in Basrah, Iraq

1. Introduction

Although P. aeruginosa is an environmental organism, it is also infrequently found on the skin, mucous membranes, and in the feces of some healthy animals (wild, companion, or farm animals) ( 1 ). P. aeruginosa is an opportunistic pathogen and infection is preceded by a breach in host defenses, such as breaks in the skin. This organism produces a variety of toxins and enzymes which promote tissue invasion and damage. P. aeruginosa demonstrates resistance to several antimicrobial agents. It is usually susceptible to the aminoglycosides, semisynthetic penicillins, such as piperacillin and ticarcillin, third- and fourth-generation cephalosporins (ceftazidime and cefepime, respectively), carbapenems (except ertapenem), and the fluoroquinolones ( 1 ). P. aeruginosa has significant importance in both human and animal medicine. Multiple studies have concentrated on clinical isolates of P. aeruginosa strains that isolated from humans; nonetheless, less attention has been paid to animal ( 2 ) and environmental strains ( 3 , 4 ). There are no specific P. aeruginosa strains associated with specific animals, diseases, or habitats ( 5 ).

The enzootic or epizootic outbreaks of mastitis in ruminants, bovine, and small ruminants are rooted in several causes. One of the bacteria involved in this occasion would be P. aeruginosa. Ruminant mastitis is of great importance to animal scientists and veterinarians. Global human population growth has increased the demand for animal proteins, especially milk of small ruminants. Consequently, animal scientists and veterinarians are striving to prevent some deleterious effects of bacterial infections which lead to a decrease in milk production. The intoxications via milk, cheese, and yogurt in the case of mastitis caused by P. aeruginosa create drastic health problems for consumers. P. aeruginosa infections occur as clinical/subclinical intramammary infections in the post-partum period and sometimes during drying-off.

In order to prove the seriousness of the presence of P. aeruginosa in the animal environment, as well as on healthy and infected animal organs where these bacteria are not expected to exist, the present study aimed to isolate and diagnose P. aeruginosa isolates from some ruminants, cow and sheep, from different regions of Basrah, Iraq, using Vitek system and molecular diagnosis performed by 16S rRNA gene and one of the Multilocus Sequence genes (aroE gene). The aroE gene which is one of the Multilocus sequence typing (MLST) is a housekeeping gene-encoded metabolic enzyme called shikimate dehydrogenase.

2. Materials and Methods

2.1. Sample Collection

The study included 200 swab samples which were divided into 100 samples from infected animals taken from the eyes, nose, mouth, ear, skin, and wounds, 50 samples from healthy animals for both cows and sheep, as well as 50 samples from the environment, including water, food, and soil which were collected by sterile transport media swabs. The samples were gathered from scattered local farms or owners from different areas of Basrah, Iraq, from March 2020 to March 2021.

2.2. Culture and Identification

The specimens were directly inoculated onto brain heart infusion broth and incubated at 37°C for 24 h. The culture was inoculated on the MacConky agar (HiMedia/India) plates to distinguish between the ferment and non-ferment lactose bacteria. The culture was also inoculated in blood sheep agars (Oxoid/ England), and both were incubated at 37°C for 24 h. The suspected single colonies were Gram stained, purified onto Pseudomonas Chromogenic Agar (Condalab/Spain), and incubated at a temperature of 35±2°C for 24-48 h. The pure colonies (Magenta colonies) were stored at 4°C. The P. aeruginosa isolates were identified according to biochemical tests recommended by Mac Faddin ( 6 ). After the confirmation of P. aeruginosa by biochemical tests, the isolates were sent to the Al-bayan laboratory to perform the bacterial identification by using the VITEK2 automated system (BiomerieuxMarcy l'Etoile, France).

2.3. Genomic DNA Extraction

The DNA extraction from the samples was performed using the gSYNCTMDNA Extrication Kit (Geneaid, Taiwan) according to company instruction. Following that, the extracted DNA was checked by Nanodrop spectrophotometer (NanoDrop® Technologies, Thermo Fisher Scientific, Basingstoke, UK) by measuring the absorbance at 260 nm, then stored in a refrigerator at -20°C until performing polymerase chain reaction (PCR).

2.4. Molecular Confirmation by 16S rRNA Detection of Some P. aeruginosa Isolates

The amplification of the 16S rRNA was performed by PCR using universal primers and PCR conditions described by Eden, Schmidt ( 7 ). The oligonucleotide primers which were used have 1500 bp and their sequence are:

F8-27 (5'-AGAGTTTGATCCTGGCTCAG-3')

R1510-1492(5'-GGTTACCTTGTTACGACTT-3')

AccuPower PCR PreMix Kit (Bioneer, Korea) contained all the components of the PCR, and the process was carried out according to company instructions (Table 1). The master mix components of the PCR were placed in standard PCR Pre Mixtubes containing all other elements needed for PCR reaction, then put in PCR Thermocycler (Labnet, USA). The products were visualized under UV light after being stained with ethidium bromide.

2.5. Molecular Confirmation by aroE Gene

A total of 42 P. aeruginosa isolates were identified via MLST of the nucleotide sequences of the gene encoding the aroE (shikimate dehydrogenase), utilizing the following primer ( 8 ):

aroE-F ATGTCACCGTGCCGTTCAAG

aroE-R TGAAGGCAGTCGGTTCCTTG

PCR conditions for all the primers are presented7 in table 2.

2.6. Sequencing

The products of amplification for 16S rRNA genes obtained from conventional PCR were sent for sequencing using automated DNA sequence by soul university Corporation, Korea. A phylogenetic tree was constructed by the maximum-likelihood algorithm MEGA- X.

Results

3.1. Culture and Identification

The P. aeruginosa isolated from samples produces circular mucoid smooth colonies with emits sweat grape odor on nutrient agar and MacConkey agar. It has been observed to make β-hemolysis on blood agar (Figure 1A) and produce Magenta colonies on Pseudomonas Chromogenic Agar (Figure 1B). All Pseudomonas isolates from different sources showed positive catalase and oxidase. The result of Kligler's Iron Agar of P. aeruginosa was as follows: Alkaline /no change (red) No H2S. No Gas. The VITEK2 test showed 52 samples with a 90% probability of p. aeruginosa. A total of 52 (26%) bacterial isolates demonstrated typical characteristics of P. aeruginosa.

Figure 1.P. aeruginosa showing hemolysis on blood agar (A), and growing on Pseudomonas Chromogenic Agar (B)

The results also demonstrated that 38% of cow samples were positive for P. aeruginosa, while sheep samples illustrated only 24% (Table 3). The healthy animals showed less availability of P. aeruginosa (6%), while the surrounding environment illustrated 36% P. aeruginosa (Table 4).

3.2. Molecular Confirmation by 16S rRNA

The amplification of the 16S rRNA gene of the isolated bacteria illustrated a product size of ≈ 1,500 bp., (Figure 2).

Figure 2. Gel electrophoresis of Pseudomonas aeruginosa 16S rRNA with product size ≈1500pb Lane (L) DNA ladder (100-3000bp), Lanes (1-10): 16S rRNA gene.

3.3. Molecular Confirmation by aroE Gene

The amplification of the aroE gene for 42 bacterial isolates yielded a positive result, and the gene size was≈ 495 bp (Figure 3).

Figure 3. Agarose electrophoresis of PCR-amplified for aroE gene of P. aeruginosa isolates. Lane L: DNA marker. Lanes (1-42) aroE gene ≈ 495 bp. Lane C: Negative control

3.4. DNA Sequencing

Nucleotides sequencing data of 16S rRNA gene for 10 isolates were given positive results of Pseudomonas aeruginosa; thereafter, the 10 isolates were recorded in GenBank/NCBI (Table 5).

3.5. Phylogenetic Tree Analysis

The phylogenetic tree of P. aeruginosa isolates pointed to a relationship between different P. aeruginosa isolates in the present study and eight strains available in GenBank as demonstrated in figure 4.

Figure 4. Rooted Neighbour Joining phylogenetic tree constructed from concatenated sequences of 1500 bp for each strain derived from an alignment of 16S rRNA gene sequences then produced from analysis conducted in MEGA X program. This N-J tree shows the distribution and phylogenetic relationships between 10 isolated Pseudomonas aeruginosa in this study and 8 reference strains.

Discussion

Although numerous studies have been conducted in Iraq, especially in Basrah ( 9 - 12 ), they were not comprehensive for the regions and types of samples, especially from infected and healthy ruminants, as well as0 their environment. The present study focused on bacteria isolated from some ruminants, including cows and sheep, from different regions in Basrah Governorate and organs of the animal body. It was not previously addressed despite the lack of local studies and its economic importance.

The majority of the isolates showed β-hemolysis on blood agar, while others isolates were non-hemolysis. All isolates grew on MacConkey agar but gave a pale-colored colony owing to an inability to ferment lactose sugar. In agreement with the result of other studies ( 13 ), all the isolates were catalase and oxidase-positive and did not produce green pigmentation on the nutrient agar plate. Suspected P. aeruginosa Chromogenic agar medium is considered a selective medium for this bacterium. It is easily distinguishable due to the magenta colony color and the color of the medium that change from green to blue-green. The rest of the bacteria are inhibited, and in case of growing, they grow as colorless colonies ( 14 ). The isolates of positive pseudomonas were identified using the VITEK2 system. The result showed that 87% of samples were identified as P. aeruginosa.

P. aeruginosa was successfully isolated from eyes (7/20), nose (2/10), mouth (1/7), ear (3/8), skin (6/17), and wounds swabs from infected cows, as well as eyes (4/18), nose (2/6), mouth (0/4), ear (1/6), skin (6/15), and wounds swabs from infected sheep, with total percentages of 38% and 24%, respectively, (2/25) and(1/25)from healthy cows and sheep, respectively, as well as (10/25) and (8/25) from the environment of cows and sheep, respectively. A higher percentage of infection was found in the cow. Eyes, skin, and wounds swabs were the highest sample given P. aeruginosa. It can be ascribed to the fact that these areas of the animal body are the most susceptible to mechanical injury and contaminants from the surrounding environment. The aforementioned results are in line with the findings of other studies ( 15 - 17 ). Healthy cows and sheep gave only three isolates of P. aeruginosa, while environmental swab recorded 18 isolates and this was expected since P. aeruginosa is an environmental infection. It is found in soil, water, feed, and farm equipment.

After the identification of bacteria with culture and Vitek-2, it was necessary to confirm the diagnosis more accurately at the level of the species, and for all samples under the study, molecular confirmation was performed by PCR amplification of genus and species with 16S rRNA gene sequences containing hypervariable regions that can provide species-specific signature sequences which are useful for bacterial identification ( 18 ). The current study identified P. aeruginosa-specific signature sequences with a universal primer. The PCR assays were used to test 10 isolates, including 5 from clinical, 4 environments, and 1 from a healthy sample.

The phylogenetic tree demonstrated two main branches from the root, one main branch includes isolates TBBV4, TBBV5, TBBV6, TBBV7, and TBBV9 which were closely related to the reference strain P. aeruginosa strain 57 16S rRNA and strain K2 16S rRNA. The second sub-branch gave two sub-branches, one sub-branch consists of three isolates TBBV8, TBBV2, and TBBV3 which were closely associated with the reference strain P. aeruginosa strain CJM. The other sub-branch contains two sub-branches, one sub-branch includes only three reference strains P. aeruginosa strains of KSG, DSIO, C16S which were not related to other isolates, and another sub-branch gave two sub-branches, one sub-branch includes only one reference strains P. aeruginosa strain NO6 which was not related to other isolates, and another sub-branch has two isolates TBBV1 and TBBV10 closely associated with one sub-branch including two reference strains P. aeruginosa strain C-1 and NO1.

Molecular confirmation of 42 isolates was performed by PCR amplification of genus and species with aroE gene. All PCR products of these isolates were amplified≈ 495 bp on agarose electrophoresis. The MLST is a typing used on several conserved housekeeping genes, namely acsA, aroE, guaA, mutL, nuoD, ppsA, and trpE ( 19 ). As a result, the molecular confirmation by aroE gene in medical microbiology is a rapid and cheap alternative to phenotypic methods of bacterial identification. Although several studies have been carried out on other types of bacteria isolated from animals ( 20 - 26 ), there is a paucity of research on the genetic diversity of P. aeruginosa in this area.

Authors' Contribution

Study concept and design: T. M. K. A.

Acquisition of data: B. A. A.

Analysis and interpretation of data: T. M. K. A.

Drafting of the manuscript: T. M. K. A.

Critical revision of the manuscript for important intellectual content: B. A. A.

Statistical analysis: B. A. A.

Administrative, technical, and material support: T. M. K. A.

Ethics

Ethical approval for the study was obtained from the Ethics Committee of the University of Basrah, Basrah, Iraq.

Conflict of Interest

The authors declare that they have no conflict of interest.

References

1. Mahon CR, Lehman DC, Manuselis G. Textbook of diagnostic microbiology-e-book: Elsevier Health Sciences; 2018.
2. Ruiz-Roldán L, Rojo-Bezares B, de Toro M, López M, Toledano P, Lozano C, et al. Antimicrobial resistance and virulence of Pseudomonas spp. among healthy animals: Concern about exolysin ExlA detection. Sci Rep. 2020; 10(1):1-11.
3. Colinon C, Jocktane D, Brothier E, Rossolini GM, Cournoyer B, Nazaret S. Genetic analyses of Pseudomonas aeruginosa isolated from healthy captive snakes: evidence of high inter‐and intrasite dissemination and occurrence of antibiotic resistance genes. Environ Microbiol. 2010; 12(3):716-29.
4. Silby MW, Winstanley C, Godfrey SA, Levy SB, Jackson RW. Pseudomonas genomes: diverse and adaptable. FEMS Microbiol Rev. 2011; 35(4):652-80.
5. Weese J. A review of multidrug resistant surgical site infections. Vet Comp Orthop Traumatol. 2008; 21(01):1-7.
6. Mac Faddin JF. Biochemical tests for identification of medical bacterial. 1980.
7. Eden PA, Schmidt TM, Blakemore RP, Pace NR. Phylogenetic analysis of Aquaspirillum magnetotacticum using polymerase chain reaction-amplified 16S rRNA-specific DNA. Int J Syst Evol Microbiol. 1991; 41(2):324-5.
8. Devereux R, Willis SG. Amplification of ribosomal RNA sequences. Springer: Molecular microbial ecology manual; 1995.
9. Behzadi P, Baráth Z, Gajdács M. It’s not easy being green: a narrative review on the microbiology, virulence and therapeutic prospects of multidrug-resistant Pseudomonas aeruginosa. Antibiotics. 2021; 10(1):42.
10. Haenni M, Hocquet D, Ponsin C, Cholley P, Guyeux C, Madec J-Y, et al. Population structure and antimicrobial susceptibility of Pseudomonas aeruginosa from animal infections in France. BMC Vet Res. 2015; 11(1):1-5.
11. Jalil M, Al-Hmudi H, Al-Alsaad L, Abdul-Hussein Z. Isolation and characterization of bacterio phagesagainst multiple drug resistant Pseudomonas aeruginosa with using the bacteriophage as a therpy in the mice model. Int J Dev Res. 2018; 7:11519.
12. Saleh W, Lafta M, Abdulrazaq A, Habib H, Naeem L. Bacteriological and histopathological evaluation of infectious lymphadenitis caused by pseudomonas aeruginosa in awasi sheep. Adv Anim Vet Sci. 2019; 7(5):378-82.
13. Darweesh AO, Shareef AA, Alriyahee FAA. Isolation and Identification of Cellulytic Ruminant Pseudomonas Aeruginosa by Classical and Molecular Methods in Basrah Province. Ann Rom Soc Cell Biol. 2021;4672-80.
14. Hossain M, Saha S, Rahman M, Singha J, Mamun A. Isolation, identification and antibiogram study of Pseudomonas aeruginosa from cattle in Bangladesh. J Vet Adv. 2013; 3(7):180-5.
15. Milivojevic D, Šumonja N, Medić S, Pavic A, Moric I, Vasiljevic B, et al. Biofilm-forming ability and infection potential of Pseudomonas aeruginosa strains isolated from animals and humans. Pathog Dis. 2018; 76(4):041.
16. Noomi B. Detection of virulence factors of Pseudomonas aeruginosa in different animals by using bacteriological and molecular methods. Iraqi J Vet Sci. 2019; 32(2):205-10.
17. Saha TK, Begum F, Kabir SL, Islam MS, Khan MSR. Characterization of bacterial isolates from skin lesions of sheep, goat and cattle in different rearing condition. Asian J Med Biol Res. 2019; 5(2):117-25.
18. Pereira F, Carneiro J, Matthiesen R, van Asch B, Pinto N, Gusmao L, et al. Identification of species by multiplex analysis of variable-length sequences. Nucleic Acids Re. 2010; 38(22):203.
19. Serrano I, De Vos D, Santos JP, Bilocq F, Leitão A, Tavares L, et al. Antimicrobial resistance and genomic rep-PCR fingerprints of Pseudomonas aeruginosa strains from animals on the background of the global population structure. BMC Vet Res. 2016; 13(1):1-8.
20. Abbas BA, Khudor MH, Saeed BM. Molecular detection of Bacillus cereus emetic toxin gene by PCR and determine its susceptibility against Punica granatum extracts. Basrah J Vet Res. 2012; 11:79.
21. Detection of Listeria monocytogenes in frozen food using a specific inlB virulence gene. Journal of Physics: Conference Series; 2021: IOP Publishing.
22. Khalid D, Abbas B. Prevalence, antibiotic susceptibility, and virulence factors of Yersinia enterocolitica isolated from raw milk in Basrah, Iraq. Bulg J Vet Med. 2021; 24(1)
23. Khudor MH, Abbas BA, Saeed BM. Molecular detection of enterotoxin (Cyt K) gene and antimicrobial susceptibility of Bacillus cereus isolates from milk and milk products. Bas J Vet Res. 2012; 11(1):164.
24. Saeed BM, Abbas BA, Al-jadaan SA. Bacteriocin Production in Bacillus cereus Food Isolates with Molecular Detection of cerA gene. Indian J Forensic Med Toxicol. 2020; 14(4):2277.
25. Detection of Bacillus cereus genes responsible for diarrheal and emetic toxins. J Physic; 2021: IOP Publishing.
26. Saeed ZK, Abbas BA, Othman RM. Molecular identification and phylogenetic analysis of lactic acid bacteria isolated from goat raw milk. Iraq J Vet Sci. 2020; 34(2):259-63.