Comparison of the Frequency of Biofilm-Forming Genes (icaABCD) in Methicillin-Resistant S. aureus Strains Isolated from Human and Livestock

1. Introduction

Staphylococcus aureus is a gram-positive bacterium colonized in the skin (as normal human flora) and the mucous membranes of humans and animals. Upon overcoming the skin barrier, the bacteria can cause multiple systemic infections with fever, acute and chronic infections, and various syndromes ( 1 ). In Livestock bacterial contamination, depending on the sanitary conditions of the environment and the equipment used, bacterial contamination often occurs during the milking process.

Bovine mastitis is caused by a variety of microorganisms, such as S. aureus and Escherichia coli. This infection can be controlled by improving farm management practices ( 2 ). Many factors are involved in the pathogenicity of this bacterium, including the ability to produce biofilms and antibiotic resistance. A biofilm can be defined as an aggregate of microorganisms stuck to biotic or abiotic surfaces. Its phenotypic and genotypic structures adapt themselves to environmental conditions ( 3 ).

Biofilm expansion enhances bacterial viability in the environment and is an important factor in the failure of antibiotics. Bacterial resistance to antibiotics has now turned into a serious challenge and has adverse effects on therapeutic interventions. These traits are carried by specific genes on bacterial chromosomes, plasmids, transposons, and/or integron gene cassettes and can be transferred from one bacterium to another ( 4 ).

The present research investigated the icaABCD and icaR genes involved in biofilm formation and the resistance and susceptibility of S. aureus to antibiotics used to control it. The icaABCD genes are synthetic genes, and the synthesis of polysaccharide intercellular adhesion occurs after the related enzyme is expressed by the icaA and the icaD genes. The icaB gene is responsible for the deacetylation of polysaccharides before they bind to cell membranes, and the icaC gene encodes a membrane protein.

Moreover, the icaR gene plays a regulatory role and inhibits the expression of the icaABCD genes, and prevents biofilm formation. However, a protein named Rbf protein prevents this process by suppressing the icaR gene ( 5 , 6 ). In addition, it identified methicillin-resistant S. aureus (MRSA) isolates in human and animal populations through detecting the presence of the mecA genes that are a component of SCCmec (a mobile genetic element of Staphylococcus bacterial species) ( 7 - 9 ). This research aimed to study biofilm production in vitro and the presence of icaABCD genes in MRSA S. aureus isolates in both human and animal groups and investigate disease transmission between human and animal strains.

2. Materials and Methods

2.1. Sampling

In this study, 85 animal and 80 human samples were obtained. Livestock samples were collected from cows suspected of mastitis, and human samples were collected from blood, infectious secretions, and endotracheal tubes. The bacterial samples were first enriched by culturing them in Brain Heart Infusion Broth. They were then transferred to a blood agar medium and incubated for 24 h at 37°C. Biochemical tests, such as Gram test, catalase, coagulase, mannitol salt agar, and deoxyribonuclease tests were then performed. It should be mentioned that several samples were discarded.

2.2. DNA Extraction

Extraction of the S. aureus genome was performed by the extraction kit (GeneAll, South Korea) according to the protocols of the manufacturer. At the end of the extraction, the DNA concentration was measured with a nanodrop device.

2.3. Identification of Staphylococcus aureus in Humans and Animals by Genotypic Method

The identities of the samples were confirmed by using the nucA gene (Figure 1) by polymerase chain reaction (PCR) with forward and reverse primer sequences of F: CTGGCATATGTATGGCAATTGTT and R: TATTGACCTGAATCAGCGTTGTCT and a number of isolates were removed. S. aureus ATCC25923 was used as the positive control for the identification of the nucA gene and Staphylococcus epidermidis ATCC12228 was used as the negative control ( 10 ).

Figure 1. Genetic profile of the nucA (664 bp).

2.4. Phenotypic Investigation of Biofilm Formation Using Congo Red Agar

For this experiment, the powder formulation of Congo red agar medium was obtained from Merck, Germany. After preparing the medium on plates, single colonies of the bacteria were cultured using the streak plate technique and incubated aerobically in an oven at 37 ˚C each for 48 h. The matte black colonies produced strong biofilms and the reddish transparent black colonies produced moderate biofilms. The red colonies were considered biofilm-negative strains ( 5 ).

2.5. Genotypic Eevaluation for Identifying the mecA Gene in Human and Livestock Isolates

The presence of the mecA gene was assessed by PCR using the specific primer for each gene as specified in table 1. The PCR (final volume 25 μl) was performed for each tube in a PCR device (Eppendorf, Germany). Each Tube contained 10x PCR buffer (2.5 μl), dNTP (150 μmol), MgCl₂ (2 mmol), 10 pmol of F and R paired primers, Tag DNA polymerase (1 unit), and DNA (2 μl). The thermocycler temperature regime is shown in table 1 and finally, PCR products were examined by agarose gel electrophoresis.

2.6. Genotypic Evaluation for Identifying the icaABCD and icaR Genes Involved in Biofilm Formation

All isolates were evaluated by PCR to examine the presence of biofilm-forming genes. Specialized primers were used for each ica genes. Each PCR reaction solution was 25 μl of this amount, buffer (2.5 μl), dNTP (150 μmol), MgCl₂ (2 mmol), 10 pmol of F and R paired primers, Tag DNA polymerase (1 unit), and DNA (2 μl). The PCR products were examined by agarose gel electrophoresis, and the thermocycler temperature regime is summarized in table 1.

2.7. Antimicrobial Susceptibility Assay

Antibiotic susceptibility was determined using the standardized Kirby-Bauer disc diffusion method on Mueller-Hinton agar (Figures 2 and 3). The antimicrobial agents tested included Chloramphenicol (30μg), Ciprofloxacin (5 μg), Erythromycin (15μg), Gentamicin (10 μg), Oxacillin (1 μg), Penicillin (10 Units), Rifampin (5 μg), Trimethoprim (5 μg), Vancomycin (30 μg), and Nitrofurantoin (300 μg). The S. aureus ATCC 25923 was used for controlling the sensitivity of the test.

Figure 2. Genetic profile of the icaA (188bp), icaB (198 bp)

Figure 3. Genetic profile of the icaB (900 bp)

2.8. Statical Analysis

The data were statistically analyzed using cross-tabulation and the Chi-square tests in SPSS software.

3. Results

The mecA gene frequency was observed to be 64.1% and 36.8% in 39 human and 35 animal isolates, respectively (Figure 4). Based on the PCR results, the frequency of ica operon genes is presented in table 2 and figures 2, 3, 5 and 6. There is a significant relationship between icaAD and mecA genes (P≤0.05) based on statistical analysis. In the phenotypic study of the biofilm production by congo red agar method, as shown in figure 7 69.2%, 15.4%, and 15.4% of the human isolates resulted in strong, moderate, and weak biofilm productions, respectively. In livestock isolates, 57.9%, 21.1%, and 21% resulted in strong, moderate, and weak biofilm productions, respectively.

Figure 4. Genetic profile of the mecA (533 bp)

Figure 5. Genetic profile of the icaR (453 bp)

Figure 6. Genetic profile of the icaC (1100 bp)

Figure 7. Biofilm formation assay on Congo Red Agar

The results of the antibiogram for both human and animal groups are summarized in table 3 and presented in figure 8. Based on these results, there was a significant relationship between icaA in rifampicin antibiotic susceptibility in human isolates (P=0.016). Moreover, a significant relationship was observed among icaC, chloramphenicol (P=0.046), and penicillin (P-value = 0.016). In animal isolates, there was a significant relationship between mecA and the sensitivity to trimethoprim (P=0.047), and also a significant relationship was observed between icaR and the sensitivity to rifampicin (P=0.033).

Figure 8. Disk diffusion test for Staphylococcus aureus

4. Discussion

The widespread prevalence of MRSA is one of the most important factors that has turned S. aureus into a dangerous pathogen that poses a serious threat to healthcare worldwide. The MRSA can easily adapt to and evolve in different environments, just as the community-associated MRSA (CA-MRSA) and LA-MRSA strains are the results of HA-MRSA evolution. Epidemiologically, HA-MRSA was first reported from hospitals and is endemic to hospitals; moreover, CA-MRSA is also prevalent in the general population, and LA-MRSA is endemic to farms ( 13 ).

LA-MRSA and HA-MRSA are drug-resistant pathogens and cover a wide range of infections. High prevalence of LA-MRSA infection has been reported in farmers, ranchers, and people in direct contact with animals, with symptoms, such as sepsis, pneumonia, and joint infections ( 14 ). S. aureus is currently one of the leading causes of infection in cattle and causes severe economic damage to the dairy industry.

A report stated that certain strains of S. aureus, such as CC130, ST425 ( 15 ) have been observed only in cows. In farms, most antibiotics are used as feed additives to enhance livestock growth, which increases antibiotic resistance and the development of LA-MRSA strains. According to a report, in the United States, approximately 80% of all produced antibiotics are used in agriculture, and a significant portion of this amount is used for non-therapeutic purposes and to enhance livestock growth ( 16 ).

The antibiotics used for livestock are from the same group of human antibiotics, which can transmit the antimicrobial resistance created in livestock to the human population ( 17 ). In a study conducted on veterinarians, 12.5% of them were infected with LA-MRSA strains ( 18 ). The spread of contamination may occur through slaughterhouse workers, farmers, and butchers, who have direct contact with contaminated meat, or through hospitals and health centers, or the environment, such as water and air ( 19 ).

The occurrence of common human-animal infections can be directly related to the prevalence of antibiotic-resistant bacteria in animals used for food ( 20 ). According to research, the mecA ( 21 ) and mecC ( 11 , 22 ) resistance genes are of animal origin. The domestication of animals, as well as the globalization of the livestock industry, have facilitated and significantly increased the exchange of bacteria between humans and animals ( 23 , 24 ).

A report by Weese, Caldwell ( 25 ) stated that MRSA can be transmitted between horses and humans and that veterinary hospital staff is more exposed to infection. There is also evidence that livestock can act as a reservoir for the emergence of S. aureus in humans ( 26 ). Moreover, the results of several studies have shown that MRSA is more of a human origin in pets ( 27 ). Price, Stegger ( 28 ) demonstrated in their study that a human-derived MSSA strain could spread to livestock and induce antibiotic resistance to methicillin and tetracycline in livestock.

A study performed by de Boer, Zwartkruis-Nahuis ( 29 ) aimed to isolate MRSA from animal feed in several countries. Based on their results, the highest contamination of meat products was reported from the Netherlands; accordingly, the contamination rates of raw meat were 11.9%, 6.10%, 2.15%, 6.2%, 10.7%, 16%, and 35.3% in retail stores, beef, veal, lamb and mutton, pork, chicken, and turkey, respectively.

Animal source foods are usually prepared for human consumption, and LA-MRSA isolates found in live animals may also be detected on animal carcasses. In addition, slaughterhouse staff may contaminate the carcass with CA-MRSA and HA-MRSA during slaughter or processing. In a study conducted in the United States, 22 out of 120 meat samples prepared from 30 meat retail centers were reported to be infected by CA-MRSA and HA-MRSA ( 30 ).

In a study, fish meat was reported to be infected with MRSA ( 31 ). This means that the global fish trade could increase the possibility of intercontinental transmission of multidrug-resistant and enterotoxigenic S. aureus ( 32 ). Biofilm is one of the most crucial pathogenicity factors in S. aureus. When bacterium attaches to surfaces and accumulates, they form biofilms, which is one of the key and most essential factors in spreading infectious diseases. The ability of bacteria to produce biofilms and adhesions makes them more resistant to antibiotics.

According to various theories, if antibiotics penetrate the biofilm, the biofilm can inactivate the antibiotics by producing enzymes. The effect of antibiotics is only on growing bacteria. Bacteria in biofilms grow more slowly, reducing the effect of antibiotics on biofilms ( 32 ). Furthermore, the high density of bacterial populations in biofilms increases the likelihood of genetic exchange in the bacterial population, which leads to the transfer of resistance genes between bacteria, resulting in increased antibiotic resistance due to horizontal gene transfer.

In addition, once the biofilm is formed, it will be easy for it to escape the immune system and cause chronic infections ( 33 ). Although some genes and other conditions are responsible for biofilm production, results of a study performed by Arciola, Baldassarri ( 34 ) showed that icaD and fnbA genes play key roles in biofilm formation. In a study conducted by Piechota, Kot ( 35 ), there was a significant relationship between ica operon and MRSA strains, which is consistent with the findings of the present study.

In a study carried out by Bimanand, Taherikalani ( 36 ), 95.8% of the isolates formed biofilms, and a significant relationship was found between icaD and fnbA genes. Ghasemian, Najar Peerayeh ( 37 ) reported that the prevalence of icaABCD genes in isolates was high, but there was no significant relationship among ica operon genes, MRSA, and MSSA. They also found that all MRSA strains contained icaABCD genes. However, in the present study, in addition to the presence of ica genes in MRSA strains, there was a significant relationship between the frequency of icaAD and mecA genes.

Serray, Oufrid ( 38 ) found a significant association between MRSA and the icaD gene. In a study conducted by Nourbakhsh and Momtaz ( 39 ), the frequency of icaC and icaB genes were 67.3% and 63.2%, respectively, and 92.2% of 188 isolates contained the mecA gene, but no significant relationship was found. Results of another study carried out by Ohadian Moghadam, Pourmand ( 40 ) reported that all MRSA isolates contained icaA and icaD genes. According to the results of a study performed by Mirzaee, Najar-Peerayeh ( 41 ), the frequency of icaABCD genes was 51.6%, 45.1%, 77.4%, and 80.6%, respectively. Moreover, they found that only 38.7% of the samples contained all four genes and that there was no significant relationship.

Based on previous studies, the expression of 100% of all operon ica genes does not prove biofilm production. However, this does not mean that it is not important in biofilm production. Each icaABCD gene plays a different role in the biofilm production process and the amount of gene expression in different samples of S. aureus can be different. According to the results of the present study, icaAD genes were significantly associated with mecA gene expression.

Besides, icaR gene expression was the exact opposite of icaABCD genes, which could indicate the importance of the icaR gene in inhibiting biofilm production. That is, the lower the icaR expression, the higher the biofilm production in the bacterium. Based on the results of the present study performed on the transmission of S. aureus strains between humans and animals, it is not possible to express a definite conclusion. However, recent research shows that bilateral transmission of S. aureus strains between humans and animals is not rare Smith ( 19 ).

Livestock-associated S. aureus is an emerging group of S. aureus worldwide, and it seems that these strains cause less infection in humans and spread from person to person than typical familiar human strains. However, this conclusion should be made with caution since good prospective studies have not been performed so far, and more extensive and accurate studies are needed in both human and animal populations.

Authors' Contribution

Study concept and design: Y. A.

Acquisition of data: C. M. M.

Analysis and interpretation of data: J. S.

Drafting of the manuscript: Y. A.

Critical revision of the manuscript for important intellectual content: Y. A.

Statistical analysis: J. S.

Administrative, technical, and material support: C. M. M.

Ethics

The present study was approved by the Ethics Committee of the Tabriz Branch, Islamic Azad University, Tabriz, Iran.

References

1. DeLeo FR, Chambers HF. Reemergence of antibiotic-resistant Staphylococcus aureus in the genomics era. J Clin Invest. 2009; 119(9):2464-74.
2. Ateba C, Bezuidenhout C, Moneoang M, Mbewe M. Antibiotic resistant Staphylococcus aureus isolated from milk in the Mafikeng Area, North-West Province, South Africa. S Afr J Sci. 2010; 106:1-6.
3. Fischetti VA, Novick RP, Ferretti JJ, Portnoy DA, Braunstein M, Rood JI. Gram-positive pathogens. 2019.
4. Turlej A, Hryniewicz W, Empel J. Staphylococcal cassette chromosome mec (Sccmec) classification and typing methods: an overview. Pol J Microbiol. 2011; 60(2):95-103.
5. Arciola CR, Campoccia D, Montanaro L. Detection of biofilm-forming strains of Staphylococcus epidermidis and S. aureus. Expert Rev Mol Diagn. 2002; 2(5):478-84.
6. Fitzpatrick F, Humphreys H, O'Gara JP. The genetics of staphylococcal biofilm formation--will a greater understanding of pathogenesis lead to better management of device-related infection?. Clin Microbiol Infect. 2005; 11(12):967-73.
7. Deurenberg RH, Vink C, Kalenic S, Friedrich AW, Bruggeman CA, Stobberingh EE. The molecular evolution of methicillin-resistant Staphylococcus aureus. Clin Microbiol Infect. 2007; 13(3):222-35.
8. Pontes DS, Pinheiro FA, Lima-Bittencourt CI, Guedes RL, Cursino L, Barbosa F, et al. Multiple antimicrobial resistance of gram-negative bacteria from natural oligotrophic lakes under distinct anthropogenic influence in a tropical region. Microb Ecol. 2009; 58(4):762-72.
9. Sabath LD, Wheeler N, Laverdiere M, Blazevic D, Wilkinson BJ. A new type of penicillin resistance of Staphylococcus aureus. Lancet (London, England). 1977; 1(8009):443-7.
10. de Almeida CC, Pizauro LJL, Soltes GA, Slavic D, de Avila FA, Pizauro JM, et al. Some coagulase negative Staphylococcus spp. isolated from buffalo can be misidentified as Staphylococcus aureus by phenotypic and Sa442 PCR methods. BMC Res Notes. 2018; 11(1):346.
11. García-Álvarez L, Holden MTG, Lindsay H, Webb CR, Brown DFJ, Curran MD, et al. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study. Lancet Infect Dis. 2011; 11(8):595-603.
12. Rohde H, Knobloch JK, Horstkotte MA, Mack D. Correlation of Staphylococcus aureus icaADBC genotype and biofilm expression phenotype. J Clin Microbiol. 2001; 39(12):4595-6.
13. Salas M, Wernecki M, Fernandez L, Iglesias B, Gutierrez D, Alvarez A, et al. Characterization of Clinical MRSA Isolates from Northern Spain and Assessment of Their Susceptibility to Phage-Derived Antimicrobials. Antibiotics (Basel). 2020; 9(8)
14. Pirolo M, Visaggio D, Gioffre A, Artuso I, Gherardi M, Pavia G, et al. Unidirectional animal-to-human transmission of methicillin-resistant Staphylococcus aureus ST398 in pig farming; evidence from a surveillance study in southern Italy. Antimicrob Resist Infect Control. 2019; 8:187.
15. Bardiau M, Yamazaki K, Duprez JN, Taminiau B, Mainil JG, Ote I. Genotypic and phenotypic characterization of methicillin-resistant Staphylococcus aureus (MRSA) isolated from milk of bovine mastitis. Lett Appl Microbiol. 2013; 57(3):181-6.
16. Martin MJ, Thottathil SE, Newman TB. Antibiotics Overuse in Animal Agriculture: A Call to Action for Health Care Providers. Am J Public Health. 2015; 105(12):2409-10.
17. Smith TC, Male MJ, Harper AL, Kroeger JS, Tinkler GP, Moritz ED, et al. Methicillin-resistant Staphylococcus aureus (MRSA) strain ST398 is present in midwestern U.S. swine and swine workers. PLoS One. 2009; 4(1):4258.
18. Wassenberg MW, Kluytmans JA, Box AT, Bosboom RW, Buiting AG, van Elzakker EP, et al. Rapid screening of methicillin-resistant Staphylococcus aureus using PCR and chromogenic agar: a prospective study to evaluate costs and effects. Clin Microbiol Infect. 2010; 16(12):1754-61.
19. Smith TC. Livestock-associated Staphylococcus aureus: the United States experience. PLoS Pathog. 2015; 11(2):1004564.
20. Smith. Animal antibiotic use has an early but important impact on the emergence of antibiotic resistance in human commensal bacteria. Proc Natl Acad Sci U S A. 2002; 99(9):6434-9.
21. Wu S, Piscitelli C, de Lencastre H, Tomasz A. Tracking the evolutionary origin of the methicillin resistance gene: cloning and sequencing of a homologue of mecA from a methicillin susceptible strain of Staphylococcus sciuri. Microb Drug Resist. 1996; 2(4):435-41.
22. Shore AC, Deasy EC, Slickers P, Brennan G, O'Connell B, Monecke S, et al. Detection of staphylococcal cassette chromosome mec type XI carrying highly divergent mecA, mecI, mecR1, blaZ, and ccr genes in human clinical isolates of clonal complex 130 methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2011; 55(8):3765-73.
23. Lowder BV, Guinane CM, Ben Zakour NL, Weinert LA, Conway-Morris A, Cartwright RA, et al. Recent human-to-poultry host jump, adaptation, and pandemic spread of Staphylococcus aureus. Proc Natl Acad Sci U S A. 2009; 106(46):19545-50.
24. Sakwinska O, Giddey M, Moreillon M, Morisset D, Waldvogel A, Moreillon P. Staphylococcus aureus host range and human-bovine host shift. Appl Environ Microbiol. 2011; 77(17):5908-15.
25. Weese JS, Caldwell F, Willey BM, Kreiswirth BN, McGeer A, Rousseau J, et al. An outbreak of methicillin-resistant Staphylococcus aureus skin infections resulting from horse to human transmission in a veterinary hospital. Vet Microbiol. 2006; 114(1-2):160-4.
26. Spoor LE, McAdam PR, Weinert LA, Rambaut A, Hasman H, Aarestrup FM, et al. Livestock origin for a human pandemic clone of community-associated methicillin-resistant Staphylococcus aureus. mBio. 2013; 4(4)
27. Haenni M, Saras E, Chatre P, Medaille C, Bes M, Madec JY, et al. A USA300 variant and other human-related methicillin-resistant Staphylococcus aureus strains infecting cats and dogs in France. J Antimicrob Chemother. 2012; 67(2):326-9.
28. Price LB, Stegger M, Hasman H, Aziz M, Larsen J, Andersen PS, et al. Staphylococcus aureus CC398: host adaptation and emergence of methicillin resistance in livestock. mBio. 2012; 3(1)
29. de Boer E, Zwartkruis-Nahuis JT, Wit B, Huijsdens XW, de Neeling AJ, Bosch T, et al. Prevalence of methicillin-resistant Staphylococcus aureus in meat. Int J Food Microbiol. 2009; 134(1-2):52-6.
30. Pu S, Han F, Ge B. Isolation and characterization of methicillin-resistant Staphylococcus aureus strains from Louisiana retail meats. Appl Environ Microbiol. 2009; 75(1):265-7.
31. Hammad AM, Watanabe W, Fujii T, Shimamoto T. Occurrence and characteristics of methicillin-resistant and -susceptible Staphylococcus aureus and methicillin-resistant coagulase-negative staphylococci from Japanese retail ready-to-eat raw fish. Int J Food Microbiol. 2012; 156(3):286-9.
32. Chon J, Sung K, Khan S. Methicillin-Resistant Staphylococcus aureus (MRSA) in Food- Producing and Companion Animals and Food Products. InTech: Frontiers in Staphylococcus aureus; 2017.
33. Costerton JW, Montanaro L, Arciola CR. Biofilm in implant infections: its production and regulation. Int J Artif Organs. 2005; 28(11):1062-8.
34. Arciola CR, Baldassarri L, Montanaro L. Presence of icaA and icaD genes and slime production in a collection of staphylococcal strains from catheter-associated infections. J Clin Microbiol. 2001; 39(6):2151-6.
35. Piechota M, Kot B, Frankowska-Maciejewska A, Gruzewska A, Wozniak-Kosek A. Biofilm Formation by Methicillin-Resistant and Methicillin-Sensitive Staphylococcus aureus Strains from Hospitalized Patients in Poland. Biomed Res Int. 2018; 2018:4657396.
36. Bimanand L, Taherikalani M, Jalilian FA, Sadeghifard N, Ghafourian S, Mahdavi Z, et al. Association between biofilm production, adhesion genes and drugs resistance in different SCCmec types of methicillin resistant Staphylococcus aureus strains isolated from several major hospitals of Iran. Iran J Basic Med Sci. 2018; 21(4):400-3.
37. Ghasemian A, Najar Peerayeh S, Bakhshi B, Mirzaee M. Comparison of Biofilm Formation between Methicillin-Resistant and Methicillin-Susceptible Isolates of Staphylococcus aureus. Iran Biomed J. 2016; 20(3):175-81.
38. Serray B, Oufrid S, Hannaoui I, Bourjilate F, Soraa N, Mliji M, et al. Genes encoding adhesion factors and biofilm formation in methicillin-resistant Staphylococcus aureus in Morocco. J Infect Dev Ctries. 2016; 10(8):863-9.
39. Nourbakhsh F, Momtaz H. Evaluation of Phenotypic and Genotypic Biofilm Formation in Staphylococcus aureus Isolates Isolated from Hospital Infections in Shahrekord, 2015. J Arak Univ Med Sci. 2016; 19(4):69-79.
40. Ohadian Moghadam S, Pourmand MR, Aminharati F. Biofilm formation and antimicrobial resistance in methicillin-resistant Staphylococcus aureus isolated from burn patients, Iran. J Infect Dev Ctries. 2014; 8(12):1511-7.
41. Mirzaee M, Najar-Peerayeh S, Behmanesh M, Forouzandeh Moghadam M, Ghasemian A-M. Biofilm Formation and Presence of ica Genes in Staphylococcus aureus Isolated from Intensive Care Unit. J Maz Univ Med Sci. 2014; 24(115):43-51.