Pharmacological Effect of Caffeine on Drosophila melanogaster: A Proof-of-Concept in vivo Study for Nootropic Investigation

1. Introduction

Aging as a process in life characterized by growth ( 1 ) can affect the nervous system and other organs, leading to the loss of tissue function over time and accumulation of cellular damage, increased oxidative stress, and changes in body metabolism ( 2 ). Aging can be influenced by many factors, including genetics, environment, metabolism, and reproduction ( 3 , 4 ). It has been estimated that 25% of the world's population will be over the age of 60 by 2030 ( 5 , 6 ). This demographic status exerts dramatic impacts on various aspects, such as psychological, social, political, and economic ( 7 , 8 ). Aging can affect the brain, for instance, in cognitive disorders, such as decreased memory function, learning, motor coordination, as well as attention disorders which can be associated with nervous system degeneration ( 2 ).

In this regard, it is crucial to discover and develop drug compounds, such as nootropics, that can overcome neurodegenerative disorders. The discovery of new chemical compounds that can improve cognitive function or even return the cognitive abilities of older people to their youth time is an exciting prospect ( 9 ). One successful attempt to increase cognitive function is the consumption of foods and drinks that contain caffeine ( 10 ) which is a psychoactive substance widely used around the world. In the United States, about 85% of adults consume caffeine, either in beverages, such as coffee, or food ( 10 , 11 ). In the studies conducted on mammals, caffeine has been shown to have a neuroprotective effect as an adenosine receptor ligand by the activation or inhibition of adenosine receptors subtypes A1 and A2A, reducing the amount of amyloid-β in the brain and increasing motor activity ( 12 ). The epidemiological evidence suggested that coffee consumption can reduce cognitive decline and dementia, as well as memory loss in humans ( 13 ).

The pre-clinical stage of nootropic drug discovery is currently carried out using mammals, such as mice, before proceeding with clinical trials ( 14 , 15 ). This process is crucial to ensure the pharmacological effect, safety, and doses required to yield the effect. Nonetheless, this process takes time and requires sufficient, if not high, budget allocation. Moreover, the use of mammalian animals in the pre-clinical test is quite challenging due to a series of strict rules and the requirement of ethical clearance ( 16 , 17 ). Due to these limitations, the use of alternative in vivo models similar to humans is urgently required. To tackle this, several model organisms, including the fruit fly, Drosophila melanogaster, were introduced.

The fruit fly, D. melanogaster, has 75% genetic similarity to humans and is equipped with comparable signal transduction pathways and homologous protein functions in the nervous system ( 17 , 18 ). In addition, D. melanogaster provides several other advantages, such as cost-effectiveness, speedy growth, and easy maintenance ( 17 ). Therefore, once it is experimentally proven that a similar nootropic effect can be observed in D. melanogaster as in the mammalian models, the exploration of potential nootropic drug compounds/supplements from natural ingredients can be carried out in the future. This can be parallel with the strategic plan of the world's Sustainable Development Goals to fulfill the discovery, creation, and development of innovative science and technology in the health sector, especially in the field of infectious and non-infectious diseases (including degenerative diseases). In light of the aforementioned issues, the present study aimed to confirm whether D. melanogaster can be used as a model organism for the assessment of nootropic drug candidates in in vivo pre-clinical settings.

2. Materials and Methods

2.1. Sample Preparation

Caffeine (Soho Nootropics, U.S.) was dissolved using distilled water to obtain a 2% caffeine in water prior to further dilution into 0.4% and 0.08%. All caffeine concentrations were subsequently added to the fly food in a ratio of 1:4.

2.2. Fly Stocks and Maintenance

In this study, we used fruit fly (D. melanogaster) as a model organism. Male and female flies aged 2-4 days old with genotype Oregon-R (wildtype) and PGRP-LB^Δ (mutant lacking functional PGRP-LB, used as an autoinflammatory model) were used in all experiments. All fly lines were obtained from the Host Defense and Responses Laboratory (Kanazawa University, Japan) and steadily maintained using regular fly food in plastic Drosophila vials.

2.3. Survival Assay

Survival assay was carried out according to a previously established protocol ( 19 ) with some modifications to assess the effect of caffeine on the lifespan of the PGRP-LB^Δ (PGRP-LB mutant). In brief, 40 D. melanogaster were assigned to four groups: Group I was the untreated control (without caffeine) and Group II-IV were caffeine-treated groups. In Group II-IV, fruit flies were maintained in caffeine-containing food at concentrations of 0.4 mM (Group II), 0.08 mM (Group III), and 0.016 mM (Group IV). The lifespan of D. melanogaster was observed up to 45-50 days.

2.4. Locomotor Assay

The locomotor assay was carried out using the negative geotaxis method according to previously published protocol ( 20 ), with slight modifications. In a nutshell, all live D. melanogaster from each group tested in this experiment were placed separately into empty marked test vials equipped with a clear finish line. The test vials were gently tapped to ensure all flies were at the bottom of the vial and subsequently observed for 15 sec. All the D. melanogaster that was able to cross the finish line at the marked vial was counted.

2.5. Cognitive Improvement Test

Cognitive testing of D. melanogaster was performed using a previously established T-maze protocol ( 21 ), with slight modifications based on Ali, Escala ( 20 ). Briefly, the T-maze is set up in a clean condition and free from fly corpse. Two groups of fruit flies that were maintained in the presence or absence of 0.016 mM caffeine were used in this experiment. All fruit flies were subjected to a 6-hour fasting procedure and subsequently placed in the T-maze elevator (connecting the starting chamber and test chamber) prior to transferring to the starting chamber. A dark ambience was assigned to the left compartment (A), and a light ambience was assigned to the right compartment (B). Grape syrup, used as a reward in this experiment, was paired with compartment B (with light), while nothing was paired with compartment A (without light). During the initiation stage, all D. melanogaster in the starting chamber were allowed to explore the T-maze space for two min.

The flies that managed to stay in compartment B during two min of testing were counted and compared to their counterparts in compartment A. This experiment was repeated three times. At the data collection stage, all flies were subjected to a similar process: flies were given two choices of compartment, compartment A without grape syrup and compartment B with the grape syrup. The test was carried out without light conditions in both chambers. This step was performed in a dark condition to eliminate the phototaxis potential of lighting to Drosophila and ensure that flies use their olfactory abilities to locate food containing compartment. After two min, light was turned on and flies in compartment B were counted. Upon the completion of this test, flies were returned to the original vial.

2.6. Gene Expression Analysis

The isolation of total RNA was carried out using flies from each group. In brief, five live flies from each group were transferred to Treff tubes before being crushed using a micropestle. The D. melanogaster RNA was extracted using Wizard SV Total RNA Isolation System (Promega). Total RNA was quantitatively measured using a nano spectrophotometer (BioDrop, U.S.).The level expression of sod1, sod2, and cat genes was assessed by quantitative reverse transcriptase PCR (RT-qPCR) method using three different sets of primers: sod1 primer set (sod1 forward primer: 5'–AGGTCAACATCACCGACTCC–3' and sod1 reverse primer: 5'–GTTGACTTGCTCAGCTCGTG–3'), sod2 primer set (sod2 forward primer: 5'–TGGCCACATCAACCACAC–3' and sod2 reverse primer: 5'– TTCCACTGCGACTCGATG –3') and cat primer set (cat forward primer: 5'–TTCCTGGATGAGATGTCGCACT–3' and cat reverse primer: 5'–TTCTGGGTGTGAATGAAGCTGG–3').

Each RT-qPCR reaction was performed in a 20 µl reaction volume using the GoTaq® 1-Step RT-qPCR System (Promega) according to the manufacturer's instructions. The expected product verification is validated using a post-amplification melt curve profile. As an internal control in the RT-qPCR assay, rp49 ribosomal protein levels were examined using a set of rp49 primers (rp49 forward primer: 5'–AGATCGTGAAGAAGCGCACCAAG–3' and rp49 reverse primer: 5'–CACCAGGAACTTCTTGAATCCGG–3'). Rotor-Gene Q thermal cycler (Qiagen, Germany) was used with the following profiles: 37°C for 15 min, 95°C for 10 min, and set at 95°C for 10 sec, 60°C for 30 sec, and 72°C for 30 sec for 40 repeated cycles, followed by the analysis of the melt curve from 60°C to 95°C. The obtained data were analyzed using the relative quantification method.

2.7. Data Processing and Analysis

All data obtained in the survival assay were analyzed using the Kaplan-Meier curve, coupled with Log-Rank statistical analysis. Locomotor, cognitive, and gene expression analyses of data were processed using the One-way ANOVA method. All statistical analyses were performed using GraphPad Prism^® 9. Data were presented as mean±S.D, and a p-value of less than 0.05 was considered statistically significant.

3. Results

3.1. Caffeine Increases the Lifespan of PGRP-LBΔ D. melanogaster

One of the phenotypic parameters related to aging is lifespan ( 22 , 23 ); therefore, survival assay is a simple approach to evaluate the effect of a drug on lifespan. The present study compared the lifespan of two D. melanogaster: Oregon-R (wildtype) and PGRP-LB^Δ (PGRP-LB mutant). As illustrated in figure 1, the lifespan scores of Oregon-R and the PGRP-LB^Δ were around 63-64 and 35-36 days, respectively. This is probably due to the knockout of the PGRP-LB gene and has been reported elsewhere ( 24 , 25 ) upon the stimulation of a proper ligand. As an amidase, PGRP-LB plays an important role in the negative regulation of the Imd pathway (NF-κB-homologue in D. melanogaster) by regulating the immune response against Gram-negative bacterial infections. The loss of PGRP-LB disrupts such function and impairs the physiological condition of flies, including the induction of premature neurodegenerative conditions and aging ( 25 ). Consequently, we decided to use PGRP-LB^Δ flies in the next experiments.

Figure 1. Comparison of lifespan of D. melanogaster Oregon R (wildtype) and PGRP-LB^Δ (mutant). Mutant line lacking PGRP-LB experienced early death phenotype, compared to Oregon flies.

Following that, we used PGRP-LB^Δ flies in the evaluation of the nootropic effect of caffeine. In the current study, caffeine was used as an example of nootropic compounds. As displayed in figure 2, higher concentrations of caffeine (0.4 mM and 0.08 mM) yielded a negative effect on the survival of flies, while caffeine at a lower concentration (0.016 mM) was safe and can promote longer survivorship of the PGRP-LB^Δ flies, in comparison to untreated control flies. This result indicates that caffeine acts in a concentration-dependent manner in D. melanogaster.

Figure 2. Survival of PGRP-LB mutant in the presence and absence of caffeine at different concentrations. Adult fruit flies aged 2-4 days were assigned to different groups and subjected to intended treatments. The flies which received no additional treatment were designated as untreated control.

3.2. Caffeine Did Not Affect the Locomotor of PGRP-LBΔ D. melanogaster

One of the observable phenotypic parameters of aging is the status of locomotor activity which denotes the ability of a subject to move from one location to another ( 20 ). In response to the consumption of certain pharmaceutical preparations, locomotor activity can be enhanced, declined, or remain steady. Subsequently, we assessed the effect of caffeine on locomotor activity of PGRP-LB^ΔD. melanogaster. It seems that routine consumption of 0.016 mM caffeine did not affect the locomotor activity of PGRP-LB^Δ flies, at least until 10 days of caffeine treatment (Figure 3). This result suggested that caffeine can increase the lifespan of flies without affecting their movement.

Figure 3. Locomotor of PGRP-LB mutant in the presence and absence of caffeine at 0.016 mM. Adult fruit flies aged 2-4 days were divided into different groups and subjected to intended treatments. The flies which received no additional treatment were designated as untreated control.

3.3. Caffeine Improves the Cognitive Function of PGRP-LBΔ D. melanogaster

Increased lifespan in PGRP-LB^Δ flies provides an indication of physiological improvement. Nevertheless, the association between this improvement and the ability of flies to recognize and memorize certain objects has remained unclear; consequently, we carried out a cognitive T-maze test to assess this issue. As depicted in figure 4, PGRP-LB^Δ flies that consumed 0.016 mM caffeine had a better ability to locate food compartments, compared to their untreated counterparts, signifying that caffeine consumption could improve the cognitive function of flies, at least in nutrition seeking-related activities.

Figure 4. Cognitive improvement in the PGRP-LB mutant in the presence of caffeine at 0.016 mM. Adult fruit flies aged 2-4 days were divided into different groups and subjected to intended treatments. The flies which received no additional treatment were designated as untreated control (**P<0.01).

3.4. Caffeine Enhances the Expression of sod1 and cat Genes

Aging has been suggested to be associated with enhanced activity of reactive oxygen species (ROS) ( 2 , 4 ). To prevent ROS-mediated aging, cells require endogenous antioxidants. Several endogenous antioxidants that have been reported to play a vital role in the neutralization of ROS are superoxide dismutases (sods), such as sod1 and sod2, as well as catalase (cat) ( 26 , 27 ). To determine whether the improvement of PGRP-LB^Δ lifespan by caffeine was achieved through the role of enhanced endogenous antioxidant activity, we assessed the expression levels of sod1, sod2, and cat in PGRP-LB^Δ flies upon treatment with 0.016 mM caffeine. As a result, it was found that caffeine at a concentration of 0.016 mM could increase the expression of sod1 and cat genes, but not sod2 (Figure 5). Such overexpression profiles of endogenous antioxidants have been reported to be important in the reduction of ROS levels ( 28 , 29 ).

Figure 5. Expression of sod1 (A) sod2 (B) and cat (C) in the PGRP-LB^Δ in the presence or absence of caffeine at 0.016 mM. Adult fruit flies aged 2-4 days were divided into different groups and subjected to intended treatments. The flies which received no additional treatment were designated as untreated control (NS, Non-Significant; **P<0.01).

4. Discussion

The PGRP-LB protein is an amidase which plays a major role in the NF-κB homolog Imd (Immune deficiency) pathway in D. melanogaster ( 30 ). This protein acts in the regulation of the immune response against Gram-negative bacterial infections ( 31 , 32 ). The absence of PGRP-LB can lead to the hyperactivation of the NF-κB Imd pathway, resulting in a hyperinflammatory response, which can cause aging occurring faster ( 25 ). The overexpression of the immune system can induce neurodegenerative events, thereby accelerating aging ( 33 ). Neurodegenerative effects can occur in the form of decreased cognitive function, memory loss, and attention disorders ( 34 , 35 ). At a later stage, neurodegenerative disorders have been linked to an early death phenotype ( 36 , 37 ). Therefore, PGRP-LB mutant fly (PGRP-LB^Δ) can be potentially used as a model organism in the in vivo investigation of drug candidates with nootropic activity to control the aging process.

How caffeine improves the lifespan of PGRP-LB^Δ flies has remained unexplored. As demonstrated in the current study, caffeine might exert its effect on cognitive improvement and lifespan probably via the enhancement of endogenous antioxidant activity. There have been credible reports of the neuroprotective effect of caffeine on mammalian models via the regulation of Nrf-2 and NF-κB in terms of antioxidant effect to overcome oxidative stress ( 38 , 39 ). Caffeine has been known as an antioxidant by mechanism as an inhibitor at adenosine receptors A1 and A2, thereby reducing the effects of oxidative stress due to inflammation ( 39 ). In agreement with this finding, previous studies using the nematode C. elegans, sheep, and pigs pointed to the beneficial effect of caffeine on cognitive function and lifespan ( 40 - 42 ).

One of the causes of neurodegenerative disorders is the excessive production of ROS. A high level of ROS can trigger nerve cell death, and this can be prevented by endogenous antioxidants ( 43 ). Endogenous antioxidants, such as superoxide dismutases and catalase, are expressed by humans and D. melanogaster ( 44 , 45 ). In the present study, it was found that caffeine at a 0.016 mM concentration can induce the expression of sod1 and cat in D. melanogaster. Such phenotypical features were possibly related to cognitive improvement and enhanced survival of PGRP-LB mutant fly. This is similar to what has been found in the mammalian animal model ( 46 , 47 ), indicating that the analysis using D. melanogaster can provide information on nootropic activity through understanding the mechanisms of inflammatory aging caused by the immune-mediated mechanisms.

Further research is required to elucidate mechanisms involved in the action of caffeine to increase the survival of PGRP-LB^Δ flies. Unveiling the mechanism of aging due to inflammation and how overexpression of antimicrobial peptides in the NF-κB pathway can augment this event can clarify whether the nootropic activity of caffeine and other nootropic agents to alleviate neuroinflammation was achieved through the increased expression of endogenous antioxidants. In general, the results of the present study can provide preliminary information on the effect of caffeine on several phenotypical characteristics related to the neurodegenerative status, such as lifespan, locomotor activity, and cognitive function, as well as the expression of endogenous antioxidant genes.

5. Conclusion

As evidenced by the results of the present study, D. melanogaster is a useful in vivo model organism to investigate the effect of caffeine on several phenotypical characteristics related to the neurodegenerative status, such as lifespan, locomotor activity, and cognitive function, as well as the expression of endogenous antioxidant genes. This study further delineated the potential of D. melanogaster to screen new drug candidates with a nootropic activity in easier and cheaper ways prior to further tests using the mammalian animal models to examine its safety and efficacy.

Authors' Contribution

Study concept and design: A. A., U. U., A. S. W. P., N.P. and F. N.

Acquisition of data: A. A., U. U., N. R. R. and R. A. R.

Analysis and interpretation of data: A. A., U. U., F. N., T. B. E. and K. D.

Drafting of the manuscript: U. U., N. R. R. and F. N.

Critical revision of the manuscript for important intellectual content: F. N., R. A. R., T. B. E. and K. D.

Statistical analysis: A. A., U. U. and F. N.

Administrative, technical, and material support: A. A., U. U., N. P., A. S. W. P. and F. N.

Study supervision: R. A. R. and F. N.

Ethics

None to be declared.

Conflict of Interest

The authors declare that they have no conflict of interest.

Grant Support

This research was financially supported by Student Creativity Program (PKM) Kemendikbud-Ristek RI to A.A., U.U., N.P., and A.S.W.P and partly supported using PDUPT research grant to F.N (Contract No. 752/UN4.22/PT.02.00/2021) from Directorate General of Higher Education, Ministry of Education, Culture, Research, and Technology, Indonesia.

Acknowledgement

We would like to offer our gratitude to Professor Yoshinobu Nakanishi and Associate Professor Takayuki Kuraishi of Kanazawa University, Japan, for the provision of Drosophila lines and to Professor Elly Wahyudin (Biofarmaka Laboratory, Hasanuddin University, Indonesia) and Isra Wahid, Ph.D (Faculty of Medicine, Hasanuddin University) for their support in providing research equipment used in this research.

References

1. Hung CW, Chen YC, Hsieh WL, Chiou SH, Kao CL. Ageing and neurodegenerative diseases. Ageing Res Rev. 2010; 9(1):S36-46.
2. Castelli V, Benedetti E, Antonosante A, Catanesi M, Pitari G, Ippoliti R, et al. Neuronal Cells Rearrangement During Aging and Neurodegenerative Disease: Metabolism, Oxidative Stress and Organelles Dynamic. Front Mol Neurosci. 2019; 12:132.
3. Rodríguez-Rodero S, Fernández-Morera JL, Menéndez-Torre E, Calvanese V, Fernández AF, Fraga MF. Aging genetics and aging. Aging Dis. 2011; 2(3):186-95.
4. Liguori I, Russo G, Curcio F, Bulli G, Aran L, Della-Morte D, et al. Oxidative stress, aging, and diseases. Clin Interv Aging. 2018; 13:757-72.
5. Knickman JR, Snell EK. The 2030 problem: caring for aging baby boomers. Health Serv Res. 2002; 37(4):849-84.
6. United Nations DoEaSA, Population Division. World Population Aging 2019: Highlights. United Nations: New York; 2019.
7. Cox C. The Sustainable Development Goals and Aging: Implications for Social Work. J Hum Rights Soc Work. 2020; 5(1):39-47.
8. Cristea M, Noja GG, Stefea P, Sala AL. The Impact of Population Aging and Public Health Support on EU Labor Markets. Int J Environ Res Public Health. 2020; 17(4):1439.
9. Froestl W, Pfeifer A, Muhs A. Cognitive Enhancers (Nootropics). Part 3: Drugs Interacting with Targets other than Receptors or Enzymes. Disease-modifying Drugs. J Alzheimers Dis. 2013; 34:1-114.
10. McLellan TM, Caldwell JA, Lieberman HR. A review of caffeine&#039;s effects on cognitive, physical and occupational performance. Neurosci Biobehav Rev. 2016; 71:294-312.
11. Cappelletti S, Piacentino D, Sani G, Aromatario M. Caffeine: cognitive and physical performance enhancer or psychoactive drug?. Curr Neuropharmacol. 2015; 13(1):71-88.
12. Cao C, Cirrito JR, Lin X, Wang L, Verges DK, Dickson A, et al. Caffeine suppresses amyloid-beta levels in plasma and brain of Alzheimer&#039;s disease transgenic mice. J Alzheimers Dis. 2009; 17(3):681-97.
13. Eskelinen MH, Kivipelto M. Caffeine as a protective factor in dementia and Alzheimer&#039;s disease. J Alzheimers Dis. 2010; 20(1): 167-74.
14. Van Dam D, De Deyn PP. Drug discovery in dementia: the role of rodent models. Nat Rev Drug Discov. 2006; 5(11):956-70.
15. NehaSodhi RK, Jaggi AS, Singh N. Animal models of dementia and cognitive dysfunction. Life Sci. 2014; 109(2):73-86.
16. Van Dam D, De Deyn PP. Animal models in the drug discovery pipeline for Alzheimer&#039;s disease. Br J Pharmacol. 2011; 164(4):1285-300.
17. Pandey UB, Nichols CD. Human disease models in Drosophila melanogaster and the role of the fly in therapeutic drug discovery. Pharmacol Rev. 2011; 63(2):411-36.
18. Nainu F, Salim E, Asri RM, Hori A, Kuraishi T. Neurodegenerative disorders and sterile inflammation: lessons from a Drosophila model. J Biochem. 2019; 166(3):213-21.
19. Nainu F, Asri RM, Arsyad A, Manggau MA, Amir MN. In vivo antibacterial activity of green algae Ulva reticulata against Staphylococcus aureus in Drosophila model of infection. Pharmacogn J. 2018; 10(5):993-7.
20. Ali YO, Escala W, Ruan K, Zhai RG. Assaying locomotor, learning, and memory deficits in Drosophila models of neurodegeneration. J Vis Exp.
21. Ma WW, Tao Y, Wang YY, Peng IF. Effects of Gardenia jasminoides extracts on cognition and innate immune response in an adult Drosophila model of Alzheimer&#039;s disease. Chin J Nat Med. 2017; 15(12):899-904.
22. Sun Y, Yolitz J, Wang C, Spangler E, Zhan M, Zou S. Aging studies in Drosophila melanogaster. Methods Mol Biol. 2013; 1048:77-93.
23. López-Otín C, Blasco MA, Partridge L, Serrano M, Kroemer G. The hallmarks of aging. Cell. 2013; 153(6):1194-217.
24. Paredes Juan C, Welchman David P, Poidevin M, Lemaitre B. Negative Regulation by Amidase PGRPs Shapes the Drosophila Antibacterial Response and Protects the Fly from Innocuous Infection. Immunity. 2011; 35(5):770-9.
25. Kounatidis I, Chtarbanova S, Cao Y, Hayne M, Jayanth D, Ganetzky B, et al. NF-κB Immunity in the Brain Determines Fly Lifespan in Healthy Aging and Age-Related Neurodegeneration. Cell Rep. 2017; 19(4):836-48.
26. Liu R, Gang L, Shen X, Xu H, Wu F, Sheng L. Binding Characteristics and Superimposed Antioxidant Properties of Caffeine Combined with Superoxide Dismutase. ACS Omega. 2019; 4(17):17417-24.
27. Wang Y, Branicky R, Noë A, Hekimi S. Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. J Cell Biol. 2018; 217(6):1915-28.
28. Liling S, Roska TP, Arfiansyah R, Maryam F, Nainu F. Pharmacological Effect of Muntingia calabura Leaves on the Expression of sod1 and sod2 in Drosophila. Biointerface Res Appl Chem. 2021; 11(5):12985-92.
29. Dimayuga FO, Wang C, Clark JM, Dimayuga ER, Dimayuga VM, Bruce-Keller AJ. SOD1 overexpression alters ROS production and reduces neurotoxic inflammatory signaling in microglial cells. J Neuroimmunol. 2007; 182(1-2):89-99.
30. Orlans J, Vincent-Monegat C, Rahioui I, Sivignon C, Butryn A, Soulère L, et al. PGRP-LB: An Inside View into the Mechanism of the Amidase Reaction. Int J Mol Sci. 2021; 22(9):4957.
31. Kurata S. Peptidoglycan recognition proteins in Drosophila immunity. Dev Comp Immunol. 2014; 42(1):36-41.
32. Zaidman-Rémy A, Hervé M, Poidevin M, Pili-Floury S, Kim M-S, Blanot D, et al. The Drosophila Amidase PGRP-LB Modulates the Immune Response to Bacterial Infection. Immunity. 2006; 24(4):463-73.
33. Garschall K, Flatt T. The interplay between immunity and aging in Drosophila. F1000Res. 2018; 7:160.
34. Murman DL. The Impact of Age on Cognition. Semin Hear. 2015; 36(3):111-21.
35. Glisky EL. Changes in Cognitive Function in Human Aging. In: Riddle DR, editor. Brain Aging: Models, Methods, and Mechanisms. CRC Press/Taylor &amp; Francis: Boca Raton (FL); 2007.
36. Mackay DF, Russell ER, Stewart K, MacLean JA, Pell JP, Stewart W. Neurodegenerative Disease Mortality among Former Professional Soccer Players. N Engl J Med. 2019; 381(19):1801-8.
37. Luo Z, Lv H, Chen Y, Xu X, Liu K, Li X, et al. Years of Life Lost Due to Premature Death and Their Trends in People With Selected Neurological Disorders in Shanghai, China, 1995–2018: A Population-Based Study. Front Neurol. 2021; 12(207)
38. Tarozzi A. Oxidative Stress in Neurodegenerative Diseases: From Preclinical Studies to Clinical Applications. J Clin Med. 2020; 9(4):1223.
39. Endesfelder S, Strauß E, Scheuer T, Schmitz T, Bührer C. Antioxidative effects of caffeine in a hyperoxia-based rat model of bronchopulmonary dysplasia. Respir Res. 2019; 20(1):88.
40. Swinbourne AM, Kind KL, Flinn T, Kleemann DO, van Wettere W. Caffeine: A potential strategy to improve survival of neonatal pigs and sheep. Anim Reprod Sci. 2021; 226:106700.
41. Bridi JC, Barros AGdA, Sampaio LR, Ferreira JCD, Antunes Soares FA, Romano-Silva MA. Lifespan Extension Induced by Caffeine in Caenorhabditis elegans is Partially Dependent on Adenosine Signaling. Front Aging Neurosci. 2015; 7(220)
42. Sutphin GL, Bishop E, Yanos ME, Moller RM, Kaeberlein M. Caffeine extends life span, improves healthspan, and delays age-associated pathology in Caenorhabditis elegans. Longev Healthspan. 2012; 1:9.
43. Uttara B, Singh AV, Zamboni P, Mahajan RT. Oxidative stress and neurodegenerative diseases: a review of upstream and downstream antioxidant therapeutic options. Curr Neuropharmacol. 2009; 7(1):65-74.
44. Ighodaro OM, Akinloye OA. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alexandria J Med. 2018; 54(4):287-93.
45. Le Bourg É. Oxidative stress, aging and longevity in Drosophila melanogaster. FEBS Lett. 2001; 498(2):183-6.
46. Weydert CJ, Cullen JJ. Measurement of superoxide dismutase, catalase and glutathione peroxidase in cultured cells and tissue. Nat Protoc. 2010; 5(1):51-66.
47. Almosawi S, Baksh H, Qareeballa A, Falamarzi F, Alsaleh B, Alrabaani M, et al. Acute Administration of Caffeine: The Effect on Motor Coordination, Higher Brain Cognitive Functions, and the Social Behavior of BLC57 Mice. Behav Sci. 2018; 8(8)