Detection and Sequencing of Iron Superoxide Dismutase Gene in Entamoeba histolytica Isolated from Patients with Diarrhea in Iraq

1. Introduction

Parasites are among serious health problems that threaten the public health of human beings due to the fact that they consume large quantities of the host’s food and are a major cause of other health problems, most importantly diarrhea, which is the cause of death, especially in children ( 1 ). The most common intestinal parasite is Entamoeba histolytica, which predominantly infects humans and other primates causing amoebiasis ( 2 ).

Superoxide dismutase (SOD) serves as a part of the organism’s defense system against highly reactive oxygen species by removing the superoxide anion (O⁻²), as to their metal cofactor, the normal environment of the trophozoites of E. histolytica in the lumen of the large intestine is basically anaerobic and maintenance of a low redox-potential of 150 mv or lower, is obligatory to its optimal growth in vitro. Entamoeba histolytica has been anaerobe; however, the pathogen has also been shown to be oxygen tolerant and to consume oxygen under certain conditions ( 3 ).It was shown to tolerate up to 5% oxygen in the gas phase and able to detoxify the product of oxygen reduction in the medium ( 4 ). Entamoeba histolytica lacks catalase, peroxidase, and enzymes of glutathione metabolism ( 5 ). Iron-containing (Fe) SOD is found in this pathogen. If toxic superoxide anion (O⁻²) is formed by the partial reduction of oxygen in a variety of aerobic enzymatic oxidations, it would be removed with the formation of H2O; however, H2O2 would be detoxified in the absence of catalase. It should be amoebicidal in vitro using an enzymatic H2O2-generating system ( 6 ). For the invasion of aerobic tissues by E. histolytic, the superoxide radicals produced by the cell involved in host defense and those formed due to oxidative metabolism of the parasite need to be detoxified. The amoebic SOD has been characterized as a Fe-containing enzyme ( 7 ). The sensitivity of amoebic SOD to H2O2and the aerobic production of H2O2by the amoeba require cytoplasmic separation of the enzyme and H2O2. The presence of SOD in E. histolytica provides a basis, at least partially, of aero tolerance in amoeba ( 8 ).

The present study was conducted to molecular detection and sequencing of FeSOD genes of E. histolytica.

2. Materials and Methods

2.1. Patients

This cross-sectional study was carried out within March-August 2020 on 100 patients (60 males, 40 females) being diagnosed by specialist physicians in Babylon Province, Iraq, depending on clinical features.

2.2. Diagnosis of Parasites

The collected fresh stool samples were examined using the direct saline/iodine wet mount microscopy to detect Entamoeba trophozoites and/or cysts within 30 min for three times. The wet mount was used for the initial microscopic examination of stool and cysts were employed to demonstrate amoebic trophozoites, which can also reveal the presence of red blood cells and pus cells. After microscopic examination, about 0.2 g of each stool sample was stored at -20°C until used for molecular analysis.

2.3. DNA Extraction

Genomic DNA from stool samples was extracted using the AccuPrep® stool DNA Extraction Kit (Bioneer, Korea) according to the instructions of the manufacture. Finally, the purified DNA concentrate was eluted from the silica membrane spin column with a low salt buffer. The extracted genomic DNA from stool was estimated using a Nanodrop spectrophotometer (THERMO, USA) that checks and measures the purity of DNA through reading the absorbance at 260/280 nm; afterward, each sample was labeled and stored at -20°C.

2.4. Confirmed Detection of Entamoeba histolytica by a Conventional Polymerase Chain Reaction

A conventional polymerase chain reaction (PCR) was performed, and PCR amplification was conducted using a thermal cycler (Bioneer, Korea) with 20 μl reaction volumes that consisted of 10 μl Hot Start Master Mix (containing Taq DNA polymerase, dNTPs, Tris-HCl pH: 9.0, KCl, MgCl₂, stabilizer, and tracking dye) (Intron, Korea), 2 μl of both the forward and reverse primers (10 pmol for each), the specific primer (EHP1) F:CGATTTTCCCAGTAGAAATTA and R:CAAAATGGTCGTCTAGGC (135bp),5 μl of DNA template, and 13 μl of PCR water. The PCR cycling and running parameters were defined as one cycle of initial denaturation at 954°C for 5 min, followed by 30 cycles of 94°C for 30 sec, 58°C for 30 sec, and 72°C for 1 min with a final extension of 72°C for 5 min. The PCR products were electrophoresed in 1% agarose gels with a 1X Tris/boric acid/EDTA buffer and stained with 3μL of ethidium bromide (BioBasic, Canada) with a 100bp DNA marker ladder (Biolab, UK).

2.5. Detection of FeSOD Gene by Sequencing

According to the results of the PCR product, four DNA samples were subjected to the sequence alignment analysis of the FeSOD gene in local E. histolytica human isolated using a Clustal W alignment tool (Mega 6.0 version). The PCR cycling and running parameters were defined as one cycle of initial denaturation at 954°C for 5 min, followed by 30 cycles of 94°C for 30 sec, 58°C for 30 sec, and 72°C for 1 min with a final extension of 72°C for 5 min.

3. Results

3.1. Diagnosis of Entamoeba histolytica Using Specific Primers

In the current study, only 24 (34.3%) out of the 70 cases diagnosed based on the morphologywere demonstratedto have E. histolytica infection. These findings canbe explained by the fact that it is difficult to identify various species of Entamoeba based on morphology using light microscopical criteria; nevertheless,it is possible to identify only those cases having E. histolyticausing specific DNA probe with aconventional PCRwith a high rate of accuracy.

The molecular diagnosis of E. histolytica parasite was based on conventional PCR using a common probe EHP for detecting all E. histolytica genotypes as shown in figure 1.

Figure 1. Agarose gel electrophoresis image showing the PCR product analysis of diagnostic EHP gene in Entamoeba histolytica from human stool samplesWhere M: marker (1500-100bp) and Lane (1-24), some positive EHP genes were shown at 135bp PCR product.

3.2. Detection of FeSOD Gene by PCR

Superoxide dismutase, which catalyzes the conversion of superoxide radicals into H2O2 and molecular oxygen, ispart of the cellular defense system that helps to protect against toxicity and damage caused by oxygen metabolism ( 9 ).In our study, the FeSOD gene was presented in 15 out of 24 E. histolytica samples (62.8%), as shown in figure 2.

Figure 2. Agarose gel electrophoresis image showing the PCR product analysis of FeSOD gene in Entamoeba histolytica from human stool samples Where M: marker (1500-100bp) and Lane (1-20), some positive FeSOD genes were shown at 505bpPCR product.

The FeSOD is expressed constitutively under both aerobic and anaerobic conditions, whereas the manganese (Mn)-SOD is induced either by aerobiosis or in the presence of superoxide radical anion and ferrous iron chelators ( 2 ).

In the human intestine, E. histolytica trophozoites normally grow under anaerobic or at least microaerobic conditions. During the process of tissue invasion, and upon contact with phagocytes, E. histolytica is exposed to substantial amounts of superoxide radicals. Therefore, the regulation of enzymes, such as SOD, might contribute to the understanding of E. histolytica pathogenicity ( 3 ).The mechanism is involved in the regulation of FeSOD expression in E. histolytica ( 1 ). (I) The regulation of FeSOD expression is performed on the transcriptional level; (II) a decrease in the level of Fe²⁺ ions increases FeSOD expression; (III) a sequence with significant homology to the iron box is found within the upstream region of the E. histolyticaFeSOD gene, capable of specific binding of nuclear proteins; and (IV) this protein-binding activity is decreased in the absence of divalent cations (in this study, Mn2+was used instead of Fe²⁺ for the band shift assays since Fe²⁺ is rapidly oxidized in vitro) ( 10 ).

The fact that elevated O2, as well as an iron chelator, is capable of inducing FeSOD expression in this E. histolytica, suggests the involvement of redox-sensitive iron-containing repressor acting at the transcriptional level of FeSOD biosynthesis. On the other hand, this kind of regulation raises questions concerning the apparent biological contradiction that the removal of Fe²⁺ from the repressor increases the amount of active Fe 2+- containing enzyme. Although the specificity of E. histolyticaFeSOD is reduced in the presence of 1, 10 phenanthroline and about 60% of the activity remains, the total activity was found to be increased substantially. It may be hypothesized that at low Fe²⁺ levels the iron molecule in E. histolyticaFeSOD is replaced by an alternative divalent cation, such as the mechanism ofMn2+that was previously reported for the FeSOD of Bacteroides fragilis ( 11 ). Another more likely explanation might be that the affinity of iron is much higher to the enzyme than to the repressor molecule. If this is the case, an increased amount of protein would be synthesized at reduced Fe²⁺ concentrations, leading to an increase in the total enzyme activity, however, a decrease in the specific FeSOD activity, which is in line with our results. In this respect, the molecular characterization of the Fur-like protein of E. histolytica is of interest for further investigation, as are additional factors that might be responsible for the regulation of FeSOD expression in E. histolytica.

3.2.1. Sequence Analysis of FeSOD

To perform FeSOD gene sequencing, four isolates of E. histolytic were submitted. The result of gene sequence analysis FeSOD was indicative of the existence of some variations. The identity is 99% when compared to standard isolates of E. histolytic as shown in figure 2. Table 1 summarizes that there is a mutation in 4 isolates of the FeSOD gene and shows that there is more than one mutation in each isolate. Accordingly, the type of location of mutations that were found could lead to differences in the effect of these mutations; some of these mutationsresult in a change in the genetic code, and consequently, a change in the amino acid at the translation.

However, this study documented that the mutation in the sequence of the gene that encode, including deletion or integration of foreign DNA between isolates, affected the sequence composition.

High-throughput sequencing offers opportunities for understanding parasite molecular evaluation within the host parasite to shed light on the in vivo dynamics of the parasite carriage and infection, the role of chance circumstance. Genetic variable within the missense leads to a significant change in the proteins, and amino acids can replace another amino acid highly similar in chemical characteristics. In this case, the protein still works naturally or the replacement of amino acid can happen in a region of the protein that does not significantly affect the secondary protein structure or function. There are also amino acids encoded by more than one code that can result in a mutation. Moreover, there were 2 (16.66%) silent mutations that did not lead to a change in the sequence of amino acids in the protein, and the silent mutation does not alter protein function.

However, there was 1(6.66%) nonsense mutation that was the same as a missense mutation, except the resulting codon code for a stop signal. It is resulted in premature termination of translation. The protein is shorter than used (or non-existent) and does not contain all the amino acids that it should have; therefore, this protein is most likely non-functional.

Nonetheless, the exhaustive characterization of parasite genetic variation within the host is an important step.

3.2.2. Determination of the Type of Mutation and Percentage

The genetic structure of the FeSOD gene analyzed by sequencing revealed that there were genetic changes, and as is tabulated in table 2, there were 14 (93.33%) substitutions of 1 (6.66%) deletion.

3.2.3. Effect of Mutations

Mutations affect the FeSOD gene through the creation of a change in the organization of the gene and its work. According to table 3, there are 11(73.33%) missense types, which may influence the phenotype. Not all mutation missenses lead to significant changes in the protein, rather, an amino acid can replace another amino acid highly similar in chemical characteristic. In this case, the protein is still working naturally or the replacement of amino acid can happen in a region of the protein that does not significantly affect the secondary protein structure or function. There are also amino acids encoded by more than one code, which could result in mutation.

Finally, there was1 (6.66%) frame shift mutation that led to a reading shift resulting in a completely different type of translation originally, and subsequently, a big change in the translated protein.

The FeSOD gene in different isolates of E. histolytic showed great variation in the number of nucleotides, indicating genetic instability, allowing in tragenic recombination.

The results of the present study were relatively in line with those of studies reporting similar mutations ( 12 , 13 ). Multiple sequence alignment analysis of the FeSOD gene in local E. histolytica human isolates is shown in table 4, 5, 6 and 7. However, it was performed for only four local isolates.

Entamoeba histolytica and other amitochondriate protists require particularly high amounts of extracellular iron in vitro, surpassing that of the majority of both eukaryotic and prokaryotic cells; a high iron requirement is attributable to the heavy reliance of their energy metabolism on Fe-S proteins ( 14 ). Entamoeba histolytica needs approximately 80-100 microns for optimal growth in axenic culture media ( 14 ), and iron is added to the media with the compound ammonium ferric citrate. This amount exceeds the iron requirements for the other pathogenic bacteria and fungi. This phenomenon is a consequence of amoeba metabolism, in which metal-dependent proteins for cellular detoxification, such as FeSOD ( 15 ). Talukdar et al. found that axenic amoebae cultures could reproduce in very high concentrations of iron (up to 630 um) without showing signs of intoxication ( 3 ).

Entamoeba histolytica can use Hb as an iron source and internalize this protein via the cell membrane disruption of erythrocytes by hemolysins and phospholipases. It has been reported that trophozoites possess two haem-binding proteins expressed under iron starvation and are capable of binding to the protoporphyrin ring in haem, suggesting that they function ashomophors ( 16 ).

The high rate of identity in the current study confirmed the association of certain genetic strains of E. histolytica with a specific pattern of clinical presentation. These results were in agreement with those of previous studies ( 17 ), which demonstrated the relationship of certain genetic patterns and repeated DNA sequences with specific patterns of clinical presentation.

In conclusion, numerous questions have still remained concerning the evolution of Entamoeba species, complex architecture of the genome, and structure of Entamoeba populations. There are a variety of genetic strains of E. histolytica that are associated with diarrheal illness among Iraqi patients, which are unique to this country.

Authors' Contribution

Study concept and design: W. F. H. A.

Acquisition of data: H. K. A.

Analysis and interpretation of data: L. A. A.

Drafting of the manuscript: W. F. H. A.

Critical revision of the manuscript for important intellectual content: H. K. A.

Statistical analysis: L. A. A.

Administrative, technical, and material support: W. F. H. A.

Ethics

All the procedures were approved by the Ethics Committee at the University of Babylon, Babylon, Iraq.

Conflict of Interest

The authors declare that they have no conflict of interest.

References

1. Verhagen LM, Incani RN, Franco CR, Ugarte A, Cadenas Y, Ruiz CIS, et al. High Malnutrition Rate in Venezuelan Yanomami Compared to Warao Amerindians and Creoles: Significant Associations WITH Intestinal Parasites and Anemia. PLoS One. 2013; 8(10):e77581.
2. M R-L, RM B-C, EE A. A acetaldehyde alcohol dehycrogenase-2(ELADH2) and clarhrin are involved in internalization of human transferrin by Entamoeba histolytica. Microbiology. 2011; 157(1):209 -19.
3. Espinosa A, Perdrizet G, Paz-y-Miño C G, Lanfranchi R, Phay M. Effects of iron depletion on Entamoeba histolytica alcohol dehydrogenase 2 (EhADH2) and trophozoite growth: implications for antiamoebic therapy. J Antimicrob Chemother. 2009; 63(4):675-8.
4. Jeelani G, Husain A, Sato D, Ali V, Suematsu M, Soga T, et al. Two atypical-L-cysteine-regulated NADPH-dependent oxido-reductases involved in redox maintenances L-cysteine and iron reduction, and metronidazole activation in the enteric protozoan Entamoeba histolytica. J Biol Chem. 2010; 285(35):26889-99.
5. Almasoudi H, Sabri M. Study on Cysteine Proteinase Produced by Entamoeba Histolytica. Med j Babylon. 2009.
6. Cornick S, Moreau F, Chadee K. Entamoeba histolytica Cysteine Proteinase 5 Evokes Mucin Exocytosis from Colonic Goblet Cells via αvβ3 Integrin. PLoS Pathog. 2016; 12(4):e1005579.
7. Rostami S, Rezaeian M, Jamali R, Rezaie S, Babaei Z, Hooshyar H. Differences in Entamoeba histolytica Cysteine Proteinase 5 Gene Isolated From Bandar Abbas and Tabriz, Iran. Int J Enteric Pathog. 2017; 5(2):49-53.
8. N W, k P. The IRP, IRE System in vivo : insights from mouse models. Front pharmacol. 2014; 5:176.
9. Sabaty M, Adryanczyk G, Roustan C, Cuiné S, Lamouroux C, Pignol D. Coproporphyrin Excretion and Low Thiol Levels Caused by point mutation the Rhodobacter Sphaeroides adenosyl methionine. Bacteriol. 2010; 192(5):1238-48.
10. Mishra V, Kumar A, Ali V, Nozaki T, Zhang KYJ, Bhakuni V. Glu-108 is essential for subunit assembly and dimer stability of d-phosphoglycerate dehydrogenase from Entamoeba histolytica. Mol Biochem Parasitol. 2012; 181(2):117-24.
11. Leon-Sicairos N, Reyes-Cortes R, Guadrón-Llanos AM, Madueña-Molina J, Leon-Sicairos C, Canizalez-Román A. Strategies of Intracellular Pathogens for Obtaining Iron from the Environment. BioMed research international. 2015; 2015:476534.
12. Hernández-Cuevas NA, Weber C, Hon C-C, Guillen N. Gene Expression Profiling in Entamoeba histolytica Identifies Key Components in Iron Uptake and Metabolism. PLoS One. 2014; 9(9):e107102.
13. Lee J, Park S-J, Yong T-S. Effect of Iron on Adherence and Cytotoxicity of Entamoeba histolytica to CHO Cell Monolayers. Korean J Parasitol. 2008; 46(1):37-40.
14. Singh N, Bhattacharya A, Bhattacharya S. Homologous Recombination Occurs in Entamoeba and Is Enhanced during Growth Stress and Stage Conversion. PLoS One. 2013; 8(9):e74465.
15. Murphy MS. Management of bloody diarrhoea in children in primary care. Br Med J. 2008; 336(7651):1010-5.
16. Almasoudi H, Al-Khafaji J, Al-Maamory E. Sequencing of Entamoeba Histolytic Cysteine Protease 5 (CP5) Isolated from Diarrheic Cases in Babylon Province. Glob Pharma Technol. 2019.
17. Talamás-Rohana P, Meza I. Interaction between pathogenic amebas and fibronectin: substrate degradation and changes in cytoskeleton organization. J Cell Biol. 1988; 106(5):1787-94.