Introduction
Theileria and Babesia are protozoan parasites that belong to the phylum Apicomplexa, order Piroplasmida, which has two vertebral hosts (mostly ruminants) and invertebrate vectors (ticks), which are considered to be the most important causes of parasitic diseases in Iran ( Hashemi-Fesharki, 1997 ; Heidarpour Bami et al., 2010 ; Noaman, 2013 ; Razmi et al., 2013 ). Both of these parasites are transmitted by tick vectors. The Babesia ovis carrier ticks are Rhipicephalus, Hyalomma, and Ixodes, and in contrast to the Theileria tick vectors in cattle the various species of Hyalomma ( Abdigoudarzi, 2013 ; Song et al., 2018 ). Babesiosis in sheep is considered a cause of mortality and reduced production in intensive and conventional livestock farms. Babesia ovis , B. motasi, and B. crassa species are the causative agents of ovine babesiosis; however, the first species causes a severe and fatal illness ( Noaman, 2013 ; Hasheminasab et al., 2018 ). Most of the research in this regard was conducted using microscopic and serological studies. In different parts of the country such as Khorasan, Urmia, Ardebil, Isfahan, Tehran, Tabriz, Mazandaran, and Kurdistan, the infection rates of B. ovis and B. motasi were reported to be 6.31%-44.9% and 0.5%-14%, respectively ( Razmi et al., 2002 ; Sharifi et al., 2016 ; Naderi et al., 2017 ). Babesiosis is enzootic in Iran, and despite the prevention and control measures, every year the damages caused by the disease result in death, low production, and even condemned meat. The control and prevention of tick-borne diseases are important; nevertheless, the effects of using acaricides on the environment and the content of residual drugs in livestock products are not desirable. However, the prevention measures are oriented towards vaccination and the application of diagnostic and quarantine methods ( Jongejan and Uilenberg, 1994 ; OIE, 2012 ). Infection with Babesia and Theileria spp. is detected through the observation of the parasites in the prepared blood smears and serology tests, and more recently, molecular assays such as polymerase chain reaction (PCR). In the present study, the samples were obtained from Baneh, in Kurdistan, Iran and were examined for the presence of piroplasmida protozoan by specific PCR for detecting the causative agents of babesiosis and theileriosis.
CASE HISTORY
Geographic features of the area. Samples were collected from Baneh, in Kurdistan Province, Iran. Baneh is located in the west part of the Kurdistan province and on mountainous terrains. This province is on the Iran-Iraq border and is close to Kurdistan province in Iraq. It should be noted that three different divisions were selected for blood sampling in Baneh (Figure 1).
Sheep blood samples. For the purposes of the study, a total of 66 blood samples were selected and collected for the detection of Theileria spp. and B. ovis infection. The blood samples were put inside EDTA anticoagulant tubes and were kept at a low temperature until they were delivered to the laboratory of the parasitic vaccine research and production department in Razi Vaccine and Serum Research Institute.
Morphological tick identification. The collected ticks were identified according to the morphological described keys using a light microscope for genus Hyalomma. Hyalomma ticks could be differentiated based on their size as they are medium-sized inornate ticks with long mouthparts ( Hosseini-Chegeni et al., 2013 ; Chen et al., 2015 ).
DNA isolation. For the purposes of the study, DNA was extracted and purified by Proteinase K and phenol-chloroform ( Sambrook et al., 1989 ). All the blood cells were treated by lysis buffer, centrifugation, the addition of proteinase K and SDS solution to the pellet, and finally incubation at 56oC for 1 h. For DNA isolation from ticks, first, they were ground using liquid nitrogen, mortar, and pestle, and after that, the tick lysate was subjected to lysis buffer and proteinase K treatment. The digested samples were deproteinized by phenol/chloroform/isoamyl alcohol extraction, recovered by ethanol precipitation, dried, and resolved in distilled water. The extracted DNA concentration was measured by agarose gel electrophoresis and spectrophotometry (A260). The extracted DNA was stored at -20 oC for further use in molecular experiments.
PCR specific primers. The present study made use of the specific primers of the order piroplasmida (18S rRNA gene), T. annulata (Tams1), B. ovis (18S rRNA gene), T. ovis (18S rRNA gene), and T. lestoquardi (SP protein gene and T. lestoquardi sporozoite antigen1 (SLAg1) gene) (Table 1).
Gene | Primer name | Sequence (5’to 3’) | length | Specificity |
---|---|---|---|---|
18S rRNA | 18S F2 | CAG ATA CCG TCG TAG TCC | 770 | Piroplasmida order |
18S R2 | CCT TGT TAC GAC TTC TCC | |||
Tams1 | Tms92F Tms92R Tms92nF | GAGACAAGGAATATTCTGAGTCC | 5471 | Theileria annulata |
TTAAGTGGCATATAATGACTTAAGC | 4692 | |||
CGGCACTGGAAAGAAGTACACC | ||||
18S rRNA | Bo92F | ATTGACGGAAGGGCACCACC | 3903 | Babesia ovis |
Bo92R | GATGCAGACTGCTGGTTACCC | 2564 | ||
Bo92nF | TAATTTGACTCAACACGG | |||
Bo92nR | ATCACAGACCTGTTATTGC | |||
18S rRNA | ToF | GTA GGG CTA ATA CAT GTT CGA GAC CTT C | 121 | Theileria ovis |
ToR | TGA TAC ATC GCA TCC GAA GAC | |||
SLAg1 | SLAg1 F | ATC AGC GGC AAC ACA ACC | 400 | Theileria Lestoquardi |
SLAg1 R | TTC CTG GTC ATG AGA ACC G | |||
1: The amplified fragment size by TmsF and TmsR primers | ||||
2: The amplified fragment size by TmsnF and TmsR primers | ||||
3. PCR product amplified by external primers | ||||
4: PCR product amplified by internal primers, Tams1= Theileria annulata merozoite surface antigen 1, SLAg1= Sporozoite Lestoquardi Antigen 1. |
PCR. PCR assay was performed using specific primers at the levels of order, genus, and species. Specific primers, 10 pmole each, purified DNA (1-10μg), 10x PCR Buffer, MgCl2 (1.5 mM concentration), dNTP mix at 200μM, and finally the thermostable DNA Polymerase 1U per reaction in the final volume of 20 ul in three separate applications in the Thermocycler Techne device, all of the reagents were prepared from YektaTajhiz,TM Iran.
Gel agarose electrophoresis. The PCR products were run on a 1.5% agarose concentration. The RedSafeTM-stained gel (SinaClon, Iran) was visualized by a UV transilluminator (UVItec, Cambridge, UK) using the gel documentation system.
Based on the findings, B. ovis and T. ovis infection were observed in 57 (86.4%) and 28 (42.4%) of the isolated DNA samples from asymptomatic sheep in Baneh, respectively (Figure 2). However, the result of the specific PCR for T. lestoquardi infection was negative in all the DNA samples. Furthermore, T. annulata was found in 16 (24%) DNA samples by semi-nested PCR assay. Based on the morphological diagnosis of the collected ticks, all of them were microscopically examined and diagnosed as Hyalomma spp. (Figure 3). Furthermore, semi-nested PCR assay revealed that two of the five collected Hyalomma tick lysates were positive for T. annulata.
Discussion
In the present study, Baneh as a border city in Kurdistan province was assayed for hemoprotozoan parasites in both livestock and tick vector. According to the results, a high level of protozoan infection was observed in sheep (B. ovis : 86.4%, T. ovis: 42.4% and T. annulata: 24%). However, a highly sensitive semi-nested PCR assay indicated that the rate of infection was low. It is worth noting that 24% of sheep samples were infected by T. annulata, while there was no T. lestoquardi infection. Since the hemoprotozoan parasites were detected in asymptomatic livestock hosts, the region could be considered enzootic for both Theileria and Babesia infection. The low level of hemoprotozoan parasite infection and the asymptomatic state of livestock determined the carrier state of the studied animals. This condition influences the maintenance of the infection in the region and extends the protozoan life cycle in the hosts. Under appropriate conditions, such a carrier state can have the potential risk of theileriosis and/or babesiosis incidence. Baneh is a border city and is located close to the Kurdistan province in Iraq. In recent years, due to the ethnic conflicts and crisis regarding the Iran-Iraq border, there was no strict control on the cross-border transportation livestock. Moreover, the animal husbandry in Kurdistan province is mostly traditional; therefore, the sampling was limited to the specimens which were present in tribes and villages. Furthermore, due to the security measures of the region, the required samples had to be collected under the supervision of the military forces. The results indicated that about 14% of herbivores in Iran are infected by Babesia spp. This high incidence rate in sheep and goats indicates that the infection is enzootic in many regions of Iran ( Haghi et al., 2017 ). The findings of the present study are in line with those of a recent study performed in Kurdistan, which revealed T. ovis (100%) and T. lestoquardi (0%) infection in sheep and goats by PCR on 18S rRNA gene assay ( Khezri et al., 2016 ). As mentioned earlier, in this study B. ovis infection was detected by PCR in 86.4% of the studied asymptomatic sheep in Baneh. Therefore, it can be said that the infection rate was low, while the prevalence rate was high. B. ovis infection in small ruminants has been reported in various regions of Iran, such as Khorasan province in Northeast (sheep: 24.6% and goats: 4.2%) ( Razmi et al., 2002 ), Kuhdasht, Lorestan province (sheep: 4.2% and goats: 0.5%) ( Naderi et al., 2017 ), West Azerbaijan (sheep and goats: 16.7%) ( Esmailnezhad et al., 2015 ), Northwest of Iran (sheep: 22.89%) (Bazmani et al., 2018), and Zabol in southeast of Iran (sheep: 3.75%) ( Sharifi et al., 2016 ). The above-mentioned three pathogens are reported for sheep and goat piroplasmosis in Turkey so that T. ovis was the most prevalent (35.4%), followed by B. ovis (5.4%), T. annulata (3.9%), and Theileria sp. MK (0.3%) ( Ozubek and Aktas, 2017 ). It is noteworthy that the presence of T. lestoquardi was not reported in this study or the previous ones performed in Kurdistan ( Khezri et al., 2016 ). However, there are some reports which indicate the existence of T. lestoquardi infection in five regions in the east ( Heidarpour Bami et al., 2010 ) and southwest of Iran ( Jalali et al., 2014 ). In this study, T. annulata was detected both in sheep (24%) and cattle (100%) as well as ticks (40%). In addition, T. ovis was identified in 42.4% of the samples of the present research. The results were in agreement with other studies conducted on Theileria infection. In Khorasan Razavi province, the infection rate of T. ovis was reported at 55.6% during 2009-2011 which is considered high ( Razmi et al., 2013 ). Moreover, in Ahwaz, the total infection rate of T. annulata and T. lestoquardi was detected to be 4% in the sheep population of the region ( Jalali et al., 2016 ). An important question arises about the T. annulata infection in sheep which is whether or not the infected sheep can transmit the infection to tick vectors. The answer is that since T. annulata piroplasms were not detected in the sheep infected with T. annulata, it cannot be transmitted to ticks; therefore, it is unlikely that they play a role in the preservation and transmission of T. annulata to cattle ( Leemans et al., 1999 ). One of the most important issues is the shared border with Iraq since T. annulata infection was reported in Al-Muthanna province, in Iraq which was detected by microscopic (12%) and PCR methods (30%) ( Tallaf, 2017 ). Moreover, T. annulata infection was detected using a seroprevalence survey (77.9%) and PCR assay (68.9%) in Duhok, Sulaimanyia, and Erbil governorates of Kurdistan region in Iraq ( Mohammad Al-Saeed et al., 2010 ).
In conclusion, based on the results of the present study, the incidence rate of protozoan infection in sheep was high, while the level of the parasite in blood was low for T. annulata, T. ovis, and B. ovis . This low-level infection in asymptomatic animals confirmed their carrier state, which can only be detected by the PCR method. Another important factor is the geographical situation of Baneh as a border city since the hemoprotozoan infection is present in this region. Moreover, piroplasmida infection was found in Iraq and other neighboring provinces. Therefore, animal husbandry in Baneh is at the risk of Babesia and Theileria infection. The collected data in the present study are useful for a better understanding of the epizootiology of theileriosis and babesiosis for the purpose of regional disease control and prevention.
Ethics
The authors declare that all ethical standards have been respected in the conduction of the present research. All of the procedures were performed in accordance with the guidelines of the Animal Care and Ethics Committee of Razi vaccine and serum research institute.
Grant Support
This study was financially supported by Razi Vaccine and Serum Research Institute of Iran (Grant no. 2-18-18-94151).
Authors’ Contribution
Study concept and design: Habibi, Gh.; Sepahvand-Mohammadi, E.
Acquisition of data: Habibi, Gh.; Sepahvand-Mohammadi, E.
Analysis and interpretation of data: Habibi, Gh.
Drafting of the manuscript: Habibi, Gh.
Critical revision of the manuscript for important intellectual content: Habibi, Gh.;
Statistical analysis: Habibi, Gh.;
Administrative, technical, and material support: Afshari, A., Bozorgi, S.
References
- Abdigoudarzi M. Detection of naturally infected vector ticks (acari: ixodidae) by different species of babesia and theileria agents from three different enzootic parts of iran. J Arthropod Borne Dis. 2013; 7: 164-172.
- Chen Z, Li YQ, Ren QY, Luo J, Hu Y, Li K. Morphological characteristics of normal and gynandromorphic Hyalomma asiaticum Schulze and Schlottke, 1930. Korean J Parasitol. 2015; 53(3):361-364.
- Esmailnezhad B, Fattahi P, Kheirkhah AS. A stochastic model for the cell formation problem considering machine reliability. J Industrial Engin Int. 2015; 11(3):375-89.
- Haghi MM, Etemadifar F, Fakhar M, Teshnizi SH, Soosaraei M, Shokri A, Hajihasani A, Mashhadi H. Status of babesiosis among domestic herbivores in Iran: A systematic review and meta-analysis. Parasitol Res. 2017; 116(4):1101-9.
- Hashemi-Fesharki R. Tick-borne diseases of sheep and goats and their related vectors in Iran. Parassitologia. 1997; 39: 115-117.
- Hasheminasab SS, Moradi P, Wright I. A four year epidemiological and chemotherapy survey of babesiosis and theileriosis, and tick vectors in sheep, cattle and goats in Dehgolan, Iran. Ann Parasitol. 2018; 64: 43-48.
- Heidarpour Bami M, Khazraiinia P, Haddadzadeh H, Kazemi B. Identification of Theileria species in sheep in the eastern half of Iran using nested PCR-RFLP and microscopic techniques. Iran J Vet Res. 2010; 11: 262-266.
- Hosseini-Chegeni A, Hosseini R, Tavakoli M, Telmadarraiy Z, Abdigoudarzi M. The Iranian Hyalomma (Acari: Ixodidae) with a key to the identification of male species. Persian J Acarol. 2013; 2(3): 503-529.
- Jalali SM, Jolodar A, Rasooli A, Darabifard A. Detection of Theileria lestoquardi cross infection in cattle with clinical theileriosis in Iran. Acta Parasitol. 2016; 61(4):756-61.
- Jalali SM, Khaki Z, Kazemi B, Rahbari S, Shayan P, Bandehpour M, Yasini SP. Molecular detection and identification of Theileria species by PCR-RFLP method in sheep from Ahvaz, Southern Iran. Iran J Parasitol. 2014; 9(1):99.
- Jongejan F, Uilenberg G. Ticks and control methods. Rev Sci Tech. 1994; 13: 1201-1226.
- Khezri M, Habibi G, Esmaeil-Nia K, Afshari A. The first genetic identification of Theileria ovis subtype KP019206 in sheep in Iran. Arch Razi Inst. 2016; 71(3):145-52.
- Leemans I, Brown D, Fossum C, Hooshmand-Rad P, Kirvar E, Wilkie G, Uggla A. Infectivity and cross-immunity studies of Theileria lestoquardi and Theileria annulata in sheep and cattle: II. In vitro studies. Vet Parasitol. 1999; 82(3):193-204.
- Al-Saeed AT, Omer LT, Abdo J, Habibi G, Salih DA, Seitzer U, Ahmed J. Epidemiological studies on tropical theileriosis (Theileria annulata infection of cattle) in Kurdistan Region, Iraq. Parasitol Res. 2010; 106(2):403-7.
- Naderi A, Nayebzadeh H, Gholami S. Detection of Babesia infection among human, goats and sheep using microscopic and molecular methods in the city of Kuhdasht in Lorestan Province, West of Iran. J Parasit Dis. 2017; 41(3):837-42.
- Noaman V. A molecular study on Theileria and Babesia in cattle from Isfahan province, Central Iran. J Parasit Dis. 2013; 37: 208-210.
- OIE. World organisation for animal health. Manual of diagnostic tests and vaccines for terrestrial animals., OIE, Paris; 2012.
- Ozubek S, Aktas M. Molecular and Parasitological Survey of Ovine Piroplasmosis, Including the First Report of Theileria annulata (Apicomplexa: Theileridae) in Sheep and Goats from Turkey. J Med Entomol. 2017; 54: 212-220.
- Razmi G, Pourhosseini M, Yaghfouri S, Rashidi A, Seidabadi M. Molecular detection of Theileria spp. and Babesia spp. in sheep and ixodid ticks from the northeast of Iran. J Parasitol. 2013; 99(1):77-81.
- Razmi GR, Naghibi A, Aslani MR, Fathivand M, Dastjerdi K. An epidemiological study on ovine babesiosis in the Mashhad suburb area, province of Khorasan, Iran. Vet Parasitol. 2002; 108(2):109-15.
- Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press, New York; 1989.
- Sharifi N, Ganjali M, Nabavi R, Saadati D. A study on prevalence and identification of ovine Theileria and Babesia infection in Zabol using PCR method. J Parasit Dis. 2016; 40(4):1535-9.
- Song R, Wang Q, Guo F, Liu X, Song S, Chen C. Detection of Babesia spp., Theileria spp. and Anaplasma ovis in Border Regions, northwestern China. Transbound Emerg Dis. 2018; 65(6):1537-44.
- Tallaf AK. Epidemiological and molecular study of Theileriosis in cattle in Al-Muthanna province-Iraq. J Entomol Zool Stud. 2017; 5: 2086-2091.