Introduction
Brucellosis is a chronic infection mainly caused by Brucella melitensis in small ruminants. It has remained an important zoonotic disease in multiple regions across the globe ( Castelo and Simões, 2019 ). Brucellosis is still considered an important endemic zoonosis in numerous emerging and developing countries, as well as some developed regions ( Dadar et al., 2019b ). In the last two decades, considerable efforts have been made for the eradication and control of brucellosis in caprine and ovine flocks through the culling of seropositive animals and surveillance programs ( Blasco and Molina-Flores, 2011 ).
Nonetheless, due to nomadic and marginal farming systems of ovine and caprine flocks in numerous areas, the control and eradication of Brucella infection remain a difficult task ( Blasco and Molina-Flores, 2011 ). The massive vaccination with the live vaccine of B. melitensis strain Rev.1 is recommended when brucellosis is highly prevalent (normally higher than 5%) ( Zhang et al., 2018 ). In Iran, the small ruminant brucellosis is responsible for heavy economic losses, mainly caused by the B. melitensis biovar 1 ( Behroozikhah et al., 2012 ; Dadar et al., 2019 ). Goats and sheep are usually reared in natural lands under pastoralism, grazing cultivation, and extensive system production.
The transmission of B. melitensis among ovine and caprine herds may rapidly occur through the introduction of adult males into the flock for breeding, as well as contaminated water and feed. In Iran, brucellosis infects a wide range of animal species with economic importance ( Zowghi et al., 2008 ; Behroozikhah et al., 2012 ). Up to now, B. melitensis biovars 1, 2, and 3 (predominantly 1) have been isolated from buffalo, cattle, goats, dogs, and sheep ( Zowghi et al., 2008 ). Furthermore, B. abortus biovars 1, 2, 3, 4, 5, and 9 (predominantly 3) have been reported in cattle, camel, and a small number of sheep ( Zowghi et al., 2008 ; Behroozikhah et al., 2012 ; Alamian and Dadar, 2019 ).
Sheep and goats are known as the preferred and classical hosts for B. melitensis. The epidemiological, pathological, and clinical features of ovine and caprine brucellosis caused by B. melitensis are close to the ones caused by B. abortus infections in cattle. Moreover, small ruminants contribute to the national economy by different products and by-products; moreover, they play an important role in the livelihoods of numerous marginal farmers. In light of the aforementioned issues, the current study aimed to determine the Brucella species carrying higher risks of abortion complications in sheep and goats throughout Iran.
Material and Methods
Sample Preparation. The current study examined a total of 189 samples from sheep and goats with a history of abortion, including 24 milk (16 sheep, and 8 goats), 19 abomasum content (sheep), and 146 aborted fetuses (116 sheep, and 30 goats) composed of fetal kidney, liver, abomasum, spleen, heart, and lung. The samples were sent for analysis to the Department of Brucellosis of the Razi Vaccine and Serum Research Institute (RVSRI, Karaj, Iran) from 2016 to 2019. For Brucella culture and isolation, the samples from milk and all visceral organs (kidneys, abomasum content, lungs, and liver) were collected in a sterile plastic bag and preserved at -20°C until analysis. The details of samples are described in Table 1.
Strain Amplicon | Primer set | Primer sequence (5-3’) | DNA target | size (bp) | References |
---|---|---|---|---|---|
B. abortus | IS711 | TGCCGATCACTTTCAAGGGCCTTCAT | alpha-ketoglutaratedependent dioxygenase | 498 | (Ewalt and Bricker, 2000) |
AB | GACGAACGGAATTTTTCCAATCCC | ||||
B.ovis | IS711 | CGGGTTCTGGCACCATCGTCG | TRAP transporter solute receptor, TAXI family protein | 976 | (Bricker and Halling, 1995; Ewalt and Bricker, 2000) |
B.ovis | |||||
B.suis | IS711 | GCG CGG TTT TCT GAA GGT TCA GG | indole-3-glycerol phosphate synthase | 285 | (Bricker and Halling, 1995; Ewalt and Bricker, 2000) |
B.suis | |||||
B. melitensis | IS711 | TGCCGATCACTTTCAAGGGCCTTCAT AAATCGCGTCCTTGCTGGTCTGA | hypothetical protein | 731 | (Bricker and Halling, 1995; Ewalt and Bricker, 2000) |
BM | |||||
B. abortus | BMEI0998f | ATC CTA TTG CCC CGATAA GG | Glycosyltransferase, gene wboA | 1,682 | (López-Goñi et al., 2008) |
B. melitensis | BMEI0997r | GCT TCG CAT TTT CACTGT AGC | |||
B. melitensis Rev.1 | |||||
B. abortus | BMEI0535f | GCG CAT TCT TCG GTTATG AA | Immunodominant antigen, gene bp26 | 450 | (López-Goñi et al., 2008) |
B. melitensis | BMEI0536r | CGC AGG CGA AAA CAGCTA TAA | |||
B. melitensis Rev.1 | |||||
B. abortus | BMEI1436f | ACG CAG ACG ACC TTCGGTAT | Polysaccharide deacetylase | 794 | (López-Goñi et al., 2008) |
B. melitensis | BMEI1435r | TTT ATC CAT CGC CCTGTCAC | |||
B. melitensis Rev.1 | |||||
B. abortus | BMEII0428f | GCC GCT ATT ATG TGGACT GG | Erythritol catabolism, gene eryC (Derythrulose-1-phosphate dehydrogenase) | 587 | (López-Goñi et al., 2008) |
B. melitensis | BMEII0428r | AAT GAC TTC ACG GTC GTT CG | |||
B. melitensis Rev.1 | |||||
B. abortus | BMEII0987f | CGC AGA CAG TGA CCA TCA AA | Transcriptional regulator, CRP family | 152 | (López-Goñi et al., 2008) |
B. melitensis | BMEII0987r | GTA TTC AGC CCC CGTTAC CT | |||
B. melitensis Rev.1 |
Brucella Isolation. For the bacteriological test, all individual milk samples, aborted fetal organs, and abomasum content were subjected to bacterial culture under appropriate protection in safety hoods at the RVSRI Department of Brucellosis. The primary isolation of Brucella spp. was performed by inoculating the samples on a Brucella selective supplement (containing Bacitracin (12,500 IU), polymyxin B (2,500 IU), Vancomycin (10.0mg ) Nystatin (50,000 IU), Cycloheximide (50.0mg), and Nalidixic acid (2.5mg) (Oxoid, UK), and inactivated 5% horse serum in Brucella agar (Himedia, India) and incubated for 10 days in 37°C with 10% CO2. The milk samples were centrifuged for 15 min at 3500 RPM, and subsequently, the creamy upper layer and the sediments were cultured. The bacterial cultures were discarded after 10 days of incubation if no growth was visible. The typical colonies of Brucella spp. were subjected to further analyses to obtain biotype and full identification.
Biotyping. The biotyping was performed according to Alton et al. ( Alton et al., 1988 ). Monospecific Brucella antisera A and M, as well as Brucella reference phages, were routinely prepared and applied for analysis and diagnosis of Brucella spp. in our center. A panel of biotyping analysis was performed, including agglutination with specific Brucella antisera, H2S production, CO2 dependence, lysis by specific phages, agglutination by acriflavine, as well as growth in media containing basic fuchsine and thionin. All test results were interpreted according to the OIE manual (http://www.oie.int/en/animal-health-in-the-world/animal-diseases/Brucellosis/).
DNA Extraction and Molecular Typing. Crude genomic DNA of isolated bacteria was extracted by high pure Polymerase chain reaction (PCR) template preparation kit (Ruche, Germany) and stored at -20°C until further analysis. The DNA concentration was analyzed by reading at 260/280 nm using Nanodrop Spectrophotometer (Wilmington, DE, USA). The DNA integrity was then checked by 1% agarose gel. An IS711-based polymerase chain reaction was performed on all extracted DNA to assess the presence of Brucella spp. The amplification was performed at a denaturation temperature of 95°C for 5 min, followed by 40 cycles at 95°C for 30 s, 55°C for 60 s, 72°C for 3 min, and final extension of 72°C for 10 min ( Ewalt and Bricker, 2000 ).
Species-level molecular determination was also done by multiplex PCR (Bruce-ladder) under the following conditions as 95 °C for 5 min, followed by 30 cycles at 95 °C for 30 s, 56°C for 90 s, 72°C for 3 min, 72°C for10 min ( López-Goñi et al., 2008 ). All PCR reactions were performed in a total volume of 25 μl, by 50 mM KCl, 10 mM Tris–HCl (pH 8), 1.5 mM MgCl2, 0.2 mM each four deoxynucleotide triphosphate and 0.05 IU of Taq polymerase, 0.4 mM of each primer. The amplified products were resolved by electrophoresis using a 1.5 % agarose gel. All the applied primers are described in Table 1.
Results
Brucella isolates (n=57 in total) were obtained from 20 cases out of 35 examined cases/case series (Table 2). These isolates were originated from ovine aborted fetuses (16), ovine milk (1), goat milk (1), or goat’s aborted fetuses (2) (Figure 1). The isolated bacteria exhibited typical phenotypic features of Brucella spp. All the isolates grew in 10% carbon dioxide (CO2) after 5 days of incubation at 37°C. The isolated bacteria were gram-negative and formed translucent and shiny small honey-colored colonies with a smooth surface. The isolates were further characterized at the species level, and their identity was confirmed at the biovar level using abortus, melitensis, ovis, and suis (AMOS)-PCR and Bruce-ladder, respectively. AMOS-PCR experiments identified isolates as B. melitensis, the vaccine strain Rev1 of B. melitensis or B. abortus.
Case | Species and biovar isolated | Year | Province | Source | Host species | Number of samples | Number of culture-positive samples |
---|---|---|---|---|---|---|---|
1 | B.m3 | 2016 | Khorasan Razavi | Aborted fetus | Sheep | 1 | 1 |
2 | B.m1 | 2016 | Mazandarn | Aborted fetus | Sheep | 1 | 1 |
3 | Negative | 2016 | Fars | Milk | Sheep | 1 | |
4 | Rev1 | 2016 | Kerman | Milk | Goat | 8 | 1 |
5 | Negative | 2016 | Kerman | Aborted fetus | Goat | 1 | |
6 | Negative | 2016 | Alborz | Aborted fetus | Sheep | 4 | |
7 | Negative | 2017 | Yazd | Aborted fetus | Goat | 1 | |
8 | B.m3 | 2017 | Kerman | Milk | Sheep | 1 | 1 |
9 | B.m3 | 2017 | Kerman | Aborted fetus | Sheep | 1 | 1 |
10 | B.m1 | 2017 | Zanjan | Aborted fetus | Sheep | 5 | 4 |
11 | Rev1 | 2017 | Zanjan | Aborted fetus | Sheep | 5 | 1 |
12 | B.m1 | 2018 | Semnan | Aborted fetus | Sheep | 1 | 1 |
13 | Negative | 2018 | Semnan | Milk | Sheep | 6 | |
Abomasum content | 6 | 0 | |||||
Aborted fetus | 6 | ||||||
14 | Negative | 2018 | Semnan | Milk | Sheep | 8 | 8 |
Abomasum content | |||||||
15 | Negative | 2018 | Fars | Aborted fetus | Sheep | 3 | |
16 | B.m1 | 2018 | Mazandaran | Aborted fetus | Sheep | 2 | 2 |
17 | Negative | 2018 | Mazandaran | Aborted fetus | Sheep | 4 | 5 |
Abomasum content | |||||||
18 | Negative | 2018 | Fars | Aborted fetus | Goat | 5 | |
19 | Negative | 2018 | Fars | Aborted fetus | Sheep | 16 | |
20 | B.m2 | 2018 | Alborz | Aborted fetus | Goat | 14 | 7 |
21 | B.m1 | 2018 | Fars | Aborted fetus | Sheep | 5 | 3 |
22 | Negative | 2018 | Fars | Aborted fetus | Goat | 5 | |
23 | B.m1 | 2018 | Fars | Aborted fetus | Sheep | 7 | 4 |
24 | B.m1 | 2018 | Fars | Aborted fetus | Goat | 5 | 5 |
24 | B.m1 | 2018 | Fars | Aborted fetus | Sheep | 7 | 7 |
25 | B.ab1 | 2018 | Fars | Aborted fetus | Sheep | 2 | 2 |
26 | B.m1 | 2019 | Zanjan | Aborted fetus | Sheep | 2 | 2 |
27 | Negative | 2019 | Fars | Aborted fetus | Goat | 3 | |
28 | Negative | 2019 | Fars | Aborted fetus | Sheep | 12 | |
29 | B.m1 | 2019 | Zanjan | Aborted fetus | Sheep | 4 | 4 |
30 | B.m2 | 2019 | Fars | Aborted fetus | Sheep | 4 | 4 |
31 | B.m1 | 2019 | Semnan | Aborted fetus | Sheep | 10 | 4 |
32 | Negative | 2019 | Alborz | Aborted fetus | Sheep | 2 | |
33 | B.m1 | 2019 | Zanjan | Aborted fetus | Sheep | 2 | 2 |
34 | Negative | 2019 | Fars | Aborted fetus | Sheep | 2 | |
35 | Negative | 2019 | Yazd | Aborted fetus | Goat | 1 | 0 |
Figure 1. Comparison of B. melitensis and B. abortus infections in different sheep and goat samples
Biovar Level Isolates. Consistent with AMOS-PCR results, showing a 498 bp B. abortus specific band, common to biovars 1, 2, and 4 ( Bricker and Halling, 1994 ) (Figure 3), Biotyping confirmed the presence of B. abortus biovars 1 in sheep (1 case). This isolate was confirmed as B. abortus in the Bruceladder PCR as it led to PCR products of 1682, 794, 587, 540, and 152bp in size (Figure 4). A total of 17 B. melitensis strains were isolated from 20 cases /case series, including sheep samples (n=15), as well as few goat samples (n=2), that were identified as wild type B. melitensis and B. melitensis Rev 1 vaccine strain by AMOS-PCR with a product of 731 bp (Figure 3). Although all three B. melitensis biovars were represented, the biovar 1 (n=12) was more common than biovars 2 (n=2) and 3 (n=3) (Figure 2). As evidenced by our Bruce-ladder typing, the final two cases, which were isolated from sheep fetus and goat milk, were identified as B. melitensis Rev 1 vaccine strain. All other isolates were identified as wild type B. melitensis by both AMOS-PCR (PCR product of 731 bp) and Bruce-ladder (PCR products of 1682, 794, 587, 540, 152, and 1,071bp) (Figure 4). The B. melitensis Rev.1 vaccine strain was easily identified from other B. melitensis strains by a specific additional 218-bp fragment (Figure 4).
Figure 2. Comparison of B. melitensis and B. abortus biovars in different sheep and goat samples
Figure 3. Agarose gel (1%) electrophoresis of PCR amplified products generated from DNA samples in Bruce-ladder PCR. Lane 1 shows a DNA size marker (100bp DNA ladder). Lane 2 demonstrates B. melitensis Rev1, Lane 3 and 4: B. melitensis field strain, Lane 5: B. abortus field strains, Lane 6-7: B. melitensis field strain, Lane 8: B. abortus field strains, Lane 9: negative control, Lane10: B. abortus 544, Lane 11: B. melitensis 16M
Figure 4. Agarose gel (1%) electrophoresis of PCR amplified products generated from DNA samples in Bruce-ladder PCR. Lane 1 depicts DNA size marker (1000bp DNA ladder), Lane 2 displays B. abortus RB51, Lane 3: B. melitensis Rev1, Lane 4: B. melitensis 16M, Lane 5: B. abortus 544, Lane 6: negative control, Lane7-9: B. abortus field strains, Lane10: B. melitensis field strain
Discussion
Brucellosis is recognized as one of the major neglected zoonotic diseases with significant economic importance in multiple regions all over the world. Brucellosis in small ruminants is caused by B.melitensis and B. abortus with some clinical signs including, retained placenta, the birth of weaklings, dead offspring, infertility, and abortion ( Castelo and Simões, 2019 ). It is regarded as an endemic health problem in numerous emerging and developing countries, as well as some developed regions, such as southern and western Europe.
The Brucella infection is still widespread throughout most countries of West Asia, some parts of Latin America, and the Mediterranean Basin. Massive vaccination or young female vaccination with the B. melitensis strain Rev. 1 is recommended in areas where brucellosis prevalence is high, normally greater than 5% ( Blasco and Molina-Flores, 2011 ). Bacterial culture and isolation are known as the gold standard for the diagnosis of animal brucellosis, followed by biotyping and serological tests.
In multiple Iranian investigations, Brucella infection has been assessed by PCR ( Dadar et al., 2019 ) and serology tests ( Gharekhani et al., 2016 ). Nevertheless, there is a dearth of studies exanimating Brucella species responsible for caprine and ovine brucellosis at the biovar level ( Zowghi et al., 2008 ; Behroozikhah et al., 2012 ; Dadar et al., 2019a ). Therefore, in the current study, bacteriological and molecular tests were performed (including Bruceladder not previously applied in Iran) to further characterize Brucella biodiversity in the ovine and caprine abortion samples.
The present study indicated that passive surveillance for ovine and caprine brucellosis over a four-year period allowed determining the main Brucella species and biovars currently responsible for abortion complications in Iran. The results of the current study also pointed to a significant burden of B. abortus and B. melitensis in sheep. In terms of livestock, while B. melitensis infections were common in both sheep and goats (Figure 2), B. abortus appeared to be a potential cause of abortion only in sheep. These results are in line with previous observations regarding the isolation of B. abortus from sheep, particularly in Nigeria, Brazil, and Egypt ( Wareth et al., 2015 ; Santos et al., 2016 ).
As suggested by the results of the present study, sheep brucellosis is predominantly related to B. melitensis (88%), as well as B. abortus (6%) and Rev1 (6%). In a similar vein, caprine brucellosis was also mainly associated with B. melitensis (67%), with a much lower burden of Rev1 (33%). These results were in agreement with the view that B. melitensis is the most significant caprine pathogen among Brucella spp. As depicted in Figure 2, B. melitensis biovar 1 was predominantly isolated from sheep, followed by B. melitensis biovars 2, B. melitensis biovars 3, B. melitensis Rev1, and B. abortus biovars 1.
Globally, these results are in accordance with the findings of previous studies conducted in different parts of Iran. They have reported that B. melitensis biovars 1 is endemic and widely spread in small ruminants ( Zowghi et al., 2008 , Behroozikhah et al., 2012 ). Furthermore, B. abortus biovar 1 was less prevalent in sheep aborted fetuses (6%). This finding is in agreement with a previous epidemiological study performed in Iran, reporting this biovar as occasional in sheep ( Zowghi et al., 2008 ). According to the results of the present study, B. melitensis biovars 1, B. melitensis biovars 2, B. melitensis biovars 3, B. melitensis Rev1, and B. abortus biovars 1 are the only species that have been isolated in sheep and goat fetus abortion cases.
B. melitensis biovar 1 was first reported in case of a sheep in central Iran (Isfahan) and then spread to different Iranian regions, infecting sheep and goats, as well as cattle, camels, dogs, and humans. The study performed by Ashrafganjooyi et al. on 700 samples reported B. melitensis biovar 1 as the most common biovar in sheep and goat milk samples ( Ashrafganjooyi et al., 2017 ). B. melitensis biovar 1 was also reported in Israel ( Banai et al., 1990 ), Libya ( Gameel et al., 1993 ), Oman ( Refai, 2002 ), China ( Jiang et al., 2011 ), Iran ( Zowghi et al., 2008 , Behroozikhah et al., 2012 ), and Kenya ( Muendo et al., 2012 ). Moreover, B. abortus biovar 1 was reported in Nigeria ( Ocholi et al., 2005 ), Egypt ( Wareth et al., 2015 ), Brazil ( Santos et al., 2016 ), and Iran ( Zowghi et al., 2008 ).
The results of the present study demonstrated that B. melitensis biovar 1 is the most common cause of ovine and caprine abortion in Iran. The B.melitensis biovar 2 was only reported in sheep and goats from Fars and Alborz provinces. Despite being the most prevalent biovar in China (Jiang et al., 2011), it has been less frequently reported in Mediterranean and Middle East countries. B. melitensis biovar 2 was previously reported in Iran, Turkey, and Saudi Arabia (Refai, 2002 ; Behroozikhah et al., 2012 ; Dadar et al., 2019a ), and the obtained data pointed to the incidence of this type in aborted sheep and goat of two provinces.
In the current study, B. abortus biovar 1 was isolated from a single sheep sample. The isolations of B. melitensis Rev1 from caprine milk and ovine fetus revealed the potential shedding of Rev1 in milk, as well as its capacity, to cause abortion in small ruminants, especially if the vaccination timing is not optimal. The live B. melitensis Rev 1 strain is currently applied as the exclusive vaccine for the prevention of goat and sheep brucellosis in Iran ( Banai, 2002 ). The full- and reduced-doses of Rev 1 have been both suggested as safe and effective approaches for controlling small ruminant brucellosis.
All things considered, the obtained findings, utilizing both classical and newly introduced molecular approaches, indicated that various Brucella strains are responsible for ovine and caprine abortion in Iran. Moreover, it was found that B. melitensis and B. abortus biovars are implicated to a certain extent. Although B. melitensis biovar 1 is the most virulent sheep and goat pathogen among the genus, other B. melitensis biovars, as well as B. abortus biovar 1 (in sheep), could potentially cause abortion in infected cases. Therefore, the approach used in the current study, based on both bacterial culture and PCR methods, can provide critical data on the prevention and control of the disease, as well as the selection of appropriate vaccination strategies.
Authors' Contribution
Study concept and design: M. D.
Acquisition of data: S. A.
Analysis and interpretation of data: M. D.
Drafting of the manuscript: S. A.
Critical revision of the manuscript for important intellectual content: S. A.
Statistical analysis: M. D.
Administrative, technical, and material support: S. A.
Ethics
We hereby declare all ethical standards have been respected in preparation of the submitted article.
Grant Support
This study was supported by the grant 2-18-18-036-960504 from the Razi Vaccine and Serum Research Institute (RVSRI), Agricultural Research, Education and Extension Organization (AREEO), Karaj, Iran.
References
- ReferencesAlamian S, Dadar M. Brucella abortus contamination of camel milk in two Iranian regions. Prev Vet Med. 2019; 169:104708.
- Alton G, Jones L, Angus R, Verger J. Techniques for the Brucellosis laboratory. Paris: Institute National de la Recherdie Agrononique; 1988.
- Ashrafganjooyi SH, Saedadeli N, Alamian S, Khalili M, Shirazi Z. Isolation and biotyping of Brucella spp. from sheep and goats raw milk in southeastern Iran. Trop Biomed. 2017; 34(3):507-511.
- Banai M. Control of small ruminant brucellosis by use of Brucella melitensis Rev. 1 vaccine: laboratory aspects and field observations. Vet Microbiol. 2002; 90(1-4):497-519.
- Banai M, Mayer I, Cohen A. Isolation, identification, and characterization in Israel of Brucella melitensis biovar 1 atypical strains susceptible to dyes and penicillin, indicating the evolution of a new variant. J Clin Microbiol. 1990; 28(5):1057-9.
- Behroozikhah AM, Bagheri Nejad R, Amiri K, Bahonar AR. Identification at biovar level of Brucella isolates causing abortion in small ruminants of iran. J Pathog. 2012; 2012:357235.
- Blasco JM, Molina-Flores B. Control and eradication of Brucella melitensis infection in sheep and goats. Vet Clin North Am Food Anim Pract. 2011; 27(1):95-104.
- Bricker BJ, Halling SM. Differentiation of Brucella abortus bv. 1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis bv. 1 by PCR. J Clin Microbiol. 1994; 32(11):2660-6.
- Bricker BJ, Halling SM. Enhancement of the Brucella AMOS PCR assay for differentiation of Brucella abortus vaccine strains S19 and RB51. J Clin Microbiol. 1995; 33(6):1640-2.
- Castelo C, Simões J. Risk factors of brucellosis (re-)incidence in sheep and goat flocks in an endemic area of Portugal. Trop Anim Health Prod. 2019; 51(2):487-490.
- Dadar M, Alamian S, Behrozikhah AM, Yazdani F, Kalantari A, Etemadi A, Whatmore AM. Molecular identification of Brucella species and biovars associated with animal and human infection in Iran. Vet Res Forum. 2019a; 10(4):315-321.
- Dadar M, Shahali Y, Wareth G. Molecular diagnosis of acute and chronic brucellosis in humans. InMicrobial technology for the welfare of society. Springer, Singapore; 2019b. pp. 223-245.
- Dadar M, Shahali Y, Whatmore AM. Human brucellosis caused by raw dairy products: A review on the occurrence, major risk factors and prevention. Int J Food Microbiol. 2019; 292:39-47.
- Ewalt DR, Bricker BJ. Validation of the abbreviated Brucella AMOS PCR as a rapid screening method for differentiation of Brucella abortus field strain isolates and the vaccine strains, 19 and RB51. J Clin Microbiol. 2000; 38(8):3085-6.
- Gameel SE, Mohamed SO, Mustafa AA, Azwai SM. Prevalence of camel brucellosis in Libya. Trop Anim Health Prod. 1993; 25(2):91-3.
- Gharekhani J, Rasouli M, Abbasi-Doulatshahi E, Bahrami M, Hemati Z, Rezaei A, Shahreiari A. Sero-epidemiological survey of brucellosis in small ruminants in Hamedan province, Iran. J Adv Vet Anim Res. 2016; 3(4):399-405.
- Jiang H, Fan M, Chen J, Mi J, Yu R, Zhao H, Piao D, Ke C, Deng X, Tian G, Cui B. MLVA genotyping of Chinese human Brucella melitensis biovar 1, 2 and 3 isolates. BMC Microbiol. 2011; 11:256.
- López-Goñi I, García-Yoldi D, Marín CM, de Miguel MJ, Muñoz PM, Blasco JM, Jacques I, Grayon M, Cloeckaert A, Ferreira AC, Cardoso R, Corrêa de Sá MI, Walravens K, Albert D, Garin-Bastuji B. Evaluation of a multiplex PCR assay (Bruce-ladder) for molecular typing of all Brucella species, including the vaccine strains. J Clin Microbiol. 2008; 46(10):3484-7.
- Muendo EN, Mbatha PM, Macharia J, Abdoel TH, Janszen PV, Pastoor R, Smits HL. Infection of cattle in Kenya with Brucella abortus biovar 3 and Brucella melitensis biovar 1 genotypes. Trop Anim Health Prod. 2012; 44(1):17-20.
- Ocholi RA, Kwaga JK, Ajogi I, Bale JO. Abortion due to Brucella abortus in sheep in Nigeria. Rev Sci Tech. 2005; 24(3):973-9.
- Refai M. Incidence and control of brucellosis in the Near East region. Vet Microbiol. 2002; 90(1-4):81-110.
- Santos RD, de Souza AA, Gomes SC, Socoloski SN, de Castro BG. Research on Brucella abortus antibodies in sheep from mid-north Mato Grosso State, Brazil. Veterinária e Zootecnia. 2016; 23(4):642-6.
- Wareth G, Melzer F, Tomaso H, Roesler U, Neubauer H. Detection of Brucella abortus DNA in aborted goats and sheep in Egypt by real-time PCR. BMC Res Notes. 2015; 8:212.
- Zhang N, Huang D, Wu W, Liu J, Liang F, Zhou B, Guan P. Animal brucellosis control or eradication programs worldwide: A systematic review of experiences and lessons learned. Prev Vet Med. 2018; 160:105-115.
- Zowghi E, Ebadi A, Yarahmadi M. Isolation and identification of Brucella organisms in Iran. Arch Clin Infect Dis. 2008; 3: 185-188.