Evaluation and Comparison of Clostridium Epsilon-Alpha Fusion Gene Expression Using Different Commercial Expression Vector

Introduction

Clostridia are gram-positive rods, anaerobic in their metabolism with central or subterminal heat resistant spores, and widespread in the environment, which are observed in soil, water, sewage, feces, and intestinal tract of humans and animals. Some of these bacteria are responsible for severe diseases in humans and animals, due to the production of highly potent protein toxins ( Rood and Cole, 1991 ; Cordoba et al., 2001 ; Popoff and Bouvet, 2009 ; Bakhshi et al., 2016 ). C. perfringens and C. septicum are among the most important pathogen bacteria of Clostridium genus, causing illness in domestic animals ( Hatheway, 1990 ; Mainil, 2006 ).

C. perfringens is responsible for a wide range of diseases, including food poisoning, gas gangrene, necrotizing enteritis, enterotoxemia, and intestinal tract infections in the livestock ( Songer, 1996 ; Rood et al., 2018 ). C. perfringens produces numerous different exoproteins, which are various systems of action. The major Clostridium toxins include alpha, beta, epsilon, and iota. C. perfringens is classified into five groups (A-E) on the basis of the production of these lethal toxins (McDonel, 1980 ; Li et al., 2013 ). Epsilon toxin secreted by C. perfringens types D and B is responsible for a rapidly fatal enterotoxemia in sheep, goats, and cattle. It is a member of the pore-forming toxins coded by etx gene and located on large plasmids (Sayeed et al., 2007; Uzal et al., 2010; Popoff, 2011).

Epsilon toxin is the most potent toxin of C. perfringens. It is secreted into the prototoxin form (32.9 kDa) in the intestinal tract of the infected animals that is activated by proteolytic enzymes, such as trypsin, α-chymotrypsin, and λ-protease. Epsilon toxin LD₅₀ is 50-320 ng/kg in mice depending on the type of protease used (trypsin/chymotrypsin: 50 ng/kg) (Alves et al., 2014; Ferreira et al., 2016).

C. septicum is a resident bacterium of human and animal microflora (Pilehchian Langroudi, 2015). It can produce several toxins (i.e., alpha, beta, gamma, and delta); however, alpha toxin is the major toxin and necessary for its virulence (Langroudi, 2015). This bacterium can be responsible for spontaneous myonecrosis and gas gangrene in humans and animals, braxy in cattle and goats, and heavy losses in the livestock industry. Alpha toxin is also a prototoxin (46.55 KDa) at the time of synthesis and requires cleavage by proteases for activation (Knapp et al., 2010; Langroudi, 2015). The study and evaluation of different expression vectors are required to select suitable vectors for high-level protein production.

Recently, important studies have been carried out on the fusion protein, cloning, expression, and immunogenicity of recombinant Clostridium toxins for the selection of suitable vaccine candidates. In 2006, in a study carried out by Jia-Ning C. perfringens α-β fusion gene was cloned in plasmid pZCPAB and transformed into E. coli/BL21(DE3); then, its expression was evaluated (Bai et al., 2006). Pilehchian Langroudi et al. designed C. perfringens types B and D ε-β fusion toxin and it was cloned in E. coli; subsequently, they have reported successful studies on the expression and immunogenicity of fusion toxin (Pilehchian Langroudi et al., 2011; Langroudi et al., 2013).

Previously, the authors of the present study designed a new construct containing C. perfringens epsilon toxin and C. septicum alpha toxin genes fused by a linker using bioinformatics approach and it was ligated into pJET1.2/blunt cloning vector; then, pJETεα was cloned into E. coli/TOP10. The present study used recombinant E. coli strain TOP10 containing pJETεα for the extraction of epsilon-alpha fusion gene and investigation of the expression of its fusion protein using different commercial expression vectors.

Material and Methods

Materials. Plasmid pGEM-B1 was purchased from Bioneer Company in South Korea. Plasmid pET22b (+) and plasmid pET26b (+) were prepared by Novagen (USA). Taq polymerase, deoxynucleotide triphosphate, deoxyribonucleic acid (DNA) size markers of 100 and 1000 bp, prestained protein ladder, sodium dodecyl sulfate, agarose, tris base, acrylamide, and bis-acrylamide were obtained from CinnaGen (Iran). Pfu DNA polymerase, T4 DNA ligase, plasmid DNA purification kit, geneJET gel extraction kit, and NdeI and XhoI restriction enzymes endonuclease were prepared by Fermentas (Thermo ScientificTM Germany). Nickel-nitrilotriacetic acid (Ni-NTA) Agarose was prepared by Qiagen (USA). Sheep primary antibody and conjugate anti-sheep Horseradish peroxidase were purchased from DAKO Company (Glostrup, Denmark). Bacterial strains, namely C. perfringens type D, C. septicum, and E. coli strains Rosetta and BL/21 (DE3), were obtained from Razi Vaccine and Serum Research Institute, Karaj, Iran.

Construction of Epsilon-Alpha Fusion Gene. In previous studies, pJETεα and recombinant E. coli/TOP10/pJETεα were produced. Briefly, C. perfringens and C. septicum were cultured in brain heart infusion broth, and genomic DNA extraction was performed by the phenol-chloroform method using suitable primers (epsilon toxin gene forward primer: 5΄TGGGAACTTCGATACAAGCA3΄, epsilon gene toxin reverse primer: 5΄TGAACCTCCTATTTTGTATCCCA3΄, alpha toxin gene forward primer: 5΄GAGCATATGTCAAAAAAATCTT3΄, alpha toxin gene reverse primer: 5΄CCCTCGAGTATATTATTAATTA3΄, epsilon alpha fusion gene primers: forward 5΄AATCATATGAAAAAAAATCTTGTAAAAAGT 3΄, reverse 5΄TTTCGCCGCCGCTTCCGCTTTTATTCCTGGTGCCTTAAT 3΄). Epsilon toxin gene (HQ179546.1) and alpha toxin gene (JN793989) were retrieved from GenBank, and epsilon-alpha fusion was constructed by fusion polymerase chain reaction (PCR). Then, it was cloned into pJET1.2/blunt and recombination E. coli/TOP10/pJETεα was produced.

Subcloning of ε-α Fusion Gene. The recombinant vector pJETεα was extracted by plasmid DNA purification kit (Fermentas) according to the manufacturerʼs instructions from recombinant E. coli/TOP10/pJETεα and digested by restriction enzymes NdeI and XhoI. In addition, the epsilon-alpha fusion gene was obtained using geneJET gel extraction kit from 1% agarose gel electrophoresis. The extracted epsilon-alpha fusion gene was sent to Bioneer Company for sequencing. The pGEM-B1, pET22b (+), and pET26b (+) were digested by NdeI and XhoI for the generation of sticky ends. The ε-α fusion gene was ligated into the pGEM-B1, pET22b (+), and pET26 (+) vectors by T4 DNA ligase, and the expression recombinant vectors carrying the ε-α fusion gene of C. perfringens type D and C. septicum were constructed. E. coli/Rosetta and E. coli/BL21 (DE3) were selected as expressional hosts. There were grown in Lysogeny broth (LB) medium with 50 μg/ml ampicillin. Then, the competent cells were made by temperature shock and CaCl2, and the recombinant vectors, including pGEMεα, pET22εα, and pET26εα, were transformed into the cells. The recombinant cells were confirmed by antibiotic screening in LB agar/ampicillin, colony PCR, extraction of recombinant plasmids, and sequencing of recombinant vectors by Bioneer Company for the conformation of ligation and transformation.

Expression of ε-α Fusion Protein. The recombination bacteria were inoculated in LB broth containing a selective antibiotic (ampicillin 50 μg/ml) and grown at 37°C to OD₆₀₀ of 0.65 to 0.75. To study the expression of fusion proteins was used from different isopropyl β-D-1-thiogalactopyranoside (IPTG) (range: 0.1-0.5 mM) concentrations and different growth temperatures (25, 31, and 37°C) at different times (1, 3, 6, and 18 h). Bacterial growth was continued for 18 h; subsequently, recombinant bacteria pellet was collected by centrifugation and stored at -20°C to carry out sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting.

Purification of ε-α Fusion Protein. The ε-α fusion protein, which carries a histidine tag at carboxy terminal, was purified by Ni-NTA resin. The recombination cell pellet was suspended in lysis buffer (NaH₂PO₄ 50 mM, NaCl 300 mM, and imidazole 10 mM; pH 8), and the cells were disrupted with sonication on ice (8 pulses of 45 sec with 30-sec intervals). The cell lysate was centrifuged at 13,680 g for 20 min at 4°C, and the supernatant was passed through a Ni-NTA resin column at a flow rate of 1 ml/min. The extracted fraction from the column was washed with 5 volumes of washing buffer containing imidazole. Finally, the recombinant proteins were eluted with elution buffer (NaH₂PO₄ 50 mM, NaCl 300 mM, and imidazole 250 mM; pH 8), and the purified protein was stored at 80°C for analysis by SDS-PAGE and western blotting.

Results

Subcloning of ε-α Fusion Gene. In previous studies, C. perfringens type D epsilon toxin gene and C. septicum alpha toxin gene were fused and contained pJETεα. According to the findings of sequence analysis, the length of the fusion gene is 2,358 bp, where nucleotides 1 to 984 are related to epsilon toxin gene with its signal peptide, nucleotides 985 to 1,020 form a linker sequence optimizing for E. coli, and nucleotides 1,021 to 2,358 belong to alpha toxin without its signal peptide. The NdeI and XhoI restriction sites and their flanking regions at the 3' end of epsilon and 5' end of alpha toxin genes are also present. This sequence was deposited in GenBank under the accession number of KU726861 (Kamalirousta and Pilehchian). The digested ε-α fusion gene was recovered by agarose gel extraction kit according to the instructions of the company and its sequence was confirmed by DNA sequencing. Subcloning fusion gene into expression vectors was conducted, and the vectors were transformed into E. coli/Rosetta and E. coli/BL21 (DE3). Recombinant colonies containing ε-α fusion gene were screened by growth in LB/ampicillin agar, colony PCR (empty vectors considered negative control) (Figure 1), and analysis of restriction enzymes digestion mapping in 1% agarose (Figure 2).

Figure 1. Polymerase chain reaction (PCR) analysis of recombinant cell colonies using epsilon forward and reverse primers; lane 1: 100 bp plus deoxyribonucleic acid size marker; lanes 2-3: colony PCR of E. coli/Rosetta/pET22εα; lanes 4-5: E. coli/Rosetta/pET26εα; lanes 6-7: E. coli/Rosetta/pGEMεα; lanes 8-10: E. coli/BL21/pET22εα; lanes 11-13: E. coli/BL21/pET26εα; lanes 14-16: E. coli/BL21/pGEMεα

Figure 2. Restriction digestion of pET22εα recombinant cloning vector; lane 1: 1 kb deoxyribonucleic acid size marker; lane 2: undigested pET22εα; lane 3: digested pET22εα

Fusion Protein Expression. The induction of fusion toxin expression by different concentrations of IPTG was indicated, with no significant change in the level of the recombinant protein expression (Figure 3); however, the roles of temperature and time were significant. Accordingly, at a temperature of 37°C and 6 h after induction, maximum protein expression occurred. In addition, protein expression at 31°C was better than that reported for 25°C. E. coli/Rosetta had more efficiency in the level of ε-α fusion protein expression than E. coli/BL (DE3) (Figure 4).

Figure 3.Effect of isopropyl β-D-1-thiogalactopyranoside (IPTG) and gradients on fusion protein expression; lane 1: Pageruler Prestained Protein Ladder #SM0671; lane 2: recombinant E. coli/Rosetta/pET22εα lysate before induction; lanes 3-6: recombinant E. coli/Rosetta/pET22εα lysate 6 h after induction with 0.1, 0.2, 0.3, 0.4, and 0.5 mM IPTG at 37°C

Figure 4. Growth curves of recombinant E. coli comparison to negative control in Lysogeny broth medium containing ampicillin; recombinant host strain: Rosetta; plasmid: pET22b (+); recombinant gene: epsilon-alpha fusion gene; negative control host strain: Rosetta; plasmid: pET22b (+)

Purification of ε-α Fusion Protein. The ε-α fusion protein containing a histidine tag at carboxyl terminus was purified through Ni-NTA resin and became visible as an approximately 75-kDa protein on SDS-PAGE and western blotting (Figure 5).

Figure 5. Purification of ε-α fusion protein by nickel-nitrilotriacetic acid resin and western blotting

Discussion

Clostridia are the producers of powerful toxins and exoproteins. These exotoxins are important factors in their pathogenicity and virulence. C. perfringens type D epsilon toxin and C. septicum alpha toxin play a major role in enterotoxemia and braxy ( Kennedy et al., 2005 ; Uzal et al., 2014 ). The use of clostridial toxins for the production of effective vaccines to prevent livestock diseases caused by clostridial pathogens is a common and very effective method in vaccine manufacture ( Knight et al., 1990 ). Proper cloning and expression systems are required to express and produce high-quality recombinant proteins.

The pJET1.2/blunt is a suitable vector for cloning blunt-end PCR products amplified by Pfu polymerase and other proofreading DNA polymerases. This vector is linearized with blunt-ends, which is inhibiting self-ligated vector products. The pJET1.2/blunt vector contains a lethal gene in multiple cloning site and ampR gene as selective markers. Using recombinant DNA techniques and protein fusion can construct a chimeric structure containing two or more functional and important genes, and then the chimeric structure insert the suitable host cells for cloning and replication.

Protein fusion technology is an appropriate, functional, and efficient strategy to provide an economic justification for the expression and production of proteins. The expression levels of recombinant proteins are high in bacteria, and bacterial expression systems will be suitable if there is no need for post-translational modifications. Among many expressive present systems, E. coli is quite obvious and has the best features ( Dertzbaugh, 1998 ). Due to the prokaryotic nature of epsilon and alpha toxins and no necessity of the post-translational modifications, each of these toxins was expressed in different strains of E. coli and other hosts, such as Bacillus subtilis, Lactococcus lactis, and Streptococcus pneumoniae. Furthermore, the secretion of toxins out of the cell has been reported.

Currently, fusion strategy is commonly used in production and purification processes ( Nilsson et al., 1997 ). Previously, the expression of C. perfringens alpha-beta fusion protein and its immunologic investigation methods were reported ( Bai et al., 2006 ). The expression and immunogenicity of alpha-beta2-beta1 C. perfringens recombination fusion protein in E. coli were studied and the results showed that the protein was well expressed and provided good immunity to animals ( Zeng et al., 2011 ).

A study demonstrated the expression of clostridium beta toxin in E. coli/BL21 (DE3) and E. coli/Rosetta strains. E. coli/Rosetta could increase the expression of toxin ( Bakhshi et al., 2016 ). Furthermore, in another study, C. perfringens epsilon-beta recombinant fusion protein was expressed in E. coli/Rosetta by recombinant pET22εβ and its immunogenic properties was studied in mice ( Langroudi et al., 2013 ). The purpose of the aforementioned studies was to achieve prokaryotic systems easier than Clostridium to produce toxins and then provoke more and better immune responses against these toxins.

According to the objectives of the present study, the chimeric gene was digested, purified, and ligated in expressional plasmids, namely pET22b (+), pET26b (+), and pGEM-B1. Afterward, recombinant plasmids were transformed into expressional hosts, including E. coli/Rosetta and E. coli/BL21 (DE3). The results of the SDS-PAGE and western blotting showed that the epsilon-alpha fusion protein at the E. coli/Rosetta was well expressed, but not observed in E. coli/BL21 (DE3). E. coli/Rosetta has appropriate transfer ribonucleic acid (tRNA) for rare codons (AGG, CCC, CUA, AGA, AUA, and CGG) and transcriptional RNA polymerase for T7 promoter (Steen et al., 1986; Rosano and Ceccarelli, 2014). Due to the presence of rare codons (AUA, AGG, AGA, CUA, and GGA) in the fusion gene sequence, E. coli/Rosetta is suitable for expression.

The expression of epsilon-alpha fusion protein in different IPTG gradients did not change significantly; nevertheless, it demonstrated significant changes in thermal gradients and different times; accordingly, the optimum temperature for expression was observed at 37°C and started 1 h following the induction of protein expression and continued until 22 h. The highest level of expression was at the 6th h of induction. The obtained results of this study are consistent with the findings of similar studies conducted by Goswami et al. (1996) and Langroudi et al. (2013). The use of recombinant fusion protein as a source of vaccine production requires further investigation of the vaccine parameters, such as the level of toxin, needed or unnecessary adjuvant, type and level of adjuvant, and amount of vaccine injection for at least IU/ml.

Conclusion

The results of the current study showed that E. coli/Rosetta and pET22b(+) are suitable for Clostridium epsilon-alpha fusion gene expression and can be used for further studies on the preparation of recombinant fusion vaccine.

References

1. Alves GG, Machado de Ávila RA, Chávez-Olórtegui CD, Lobato FC. Clostridium perfringens epsilon toxin: the third most potent bacterial toxin known. Anaerobe. 2014; 30:102-7.
2. Bai JN, Zhang Y, Zhao BH. Cloning of alpha-beta fusion gene from Clostridium perfringens and its expression. World J Gastroenterol. 2006; 12(8):1229-34.
3. Bakhshi F, Pilehchian Langroudi R, Eimani BG. Enhanced expression of recombinant beta toxin of Clostridium perfringens type B using a commercially available Escherichia coli strain. Onderstepoort J Vet Res. 2016; 83(1):a1136.
4. Córdoba MG, Aranda E, Medina LM, Jordano R, Córdoba JJ. Differentiation of Clostridium perfringens and Clostridium botulinum from non-toxigenic clostridia, isolated from prepared and frozen foods by PCR-DAN based methods. Nahrung. 2001; 45(2):125-8.
5. Dertzbaugh MT. Genetically engineered vaccines: an overview. Plasmid. 1998; 39(2):100-13.
6. Ferreira MR, Moreira GM, Cunha CE, Mendonça M, Salvarani FM, Moreira ÂN, Conceição FR. Recombinant Alpha, Beta, and Epsilon Toxins of Clostridium perfringens: Production Strategies and Applications as Veterinary Vaccines. Toxins (Basel). 2016; 8(11):340.
7. Goswami PP, Rupa P, Prihar NS, Garg LC. Molecular cloning of Clostridium perfringens epsilon-toxin gene and its high level expression in E. coli. Biochem Biophys Res Commun. 1996; 226(3):735-40.
8. Hatheway CL. Toxigenic clostridia. Clin Microbiol Rev. 1990; 3(1):66-98.
9. Kamalirousta M, Pilehchian R. Development of a New Bifunctional Fusion Protein of Vaccine Strains Clostridium Perfringens Type D and Clostridium Septicum Epsilon-Alpha Toxin Genes.  MRJI.  2018;  23: 1-9.
10. Kennedy CL, Krejany EO, Young LF, O'Connor JR, Awad MM, Boyd RL, Emmins JJ, Lyras D, Rood JI. The alpha-toxin of Clostridium septicum is essential for virulence. Mol Microbiol. 2005; 57(5):1357-66.
11. Knapp O, Maier E, Mkaddem SB, Benz R, Bens M, Chenal A, Geny B, Vandewalle A, Popoff MR. Clostridium septicum alpha-toxin forms pores and induces rapid cell necrosis. Toxicon. 2010; 55(1):61-72.
12. Knight PA, Queminet J, Blanchard JH, Tilleray JH. In vitro tests for the measurement of clostridial toxins, toxoids and antisera. II. Titration of Clostridium perfringens toxins and antitoxins in cell culture. Biologicals. 1990; 18(4):263-70.
13. Langroudi RP. Rare Codons Optimizer Host Strain of E. Coli Improves Expression of Clostridium Septicum Alpha Toxin Gene. Br Microbiol Res J.  2015;  10: 1-7.
14. Langroudi RP, Shamsara M, Aghaiypour K. Expression of Clostridium perfringens epsilon-beta fusion toxin gene in E. coli and its immunologic studies in mouse. Vaccine. 2013; 31(32):3295-9.
15. Li J, Adams V, Bannam TL, Miyamoto K, Garcia JP, Uzal FA, Rood JI, McClane BA. Toxin plasmids of Clostridium perfringens. Microbiol Mol Biol Rev. 2013; 77(2):208-33.
16. Mainil J. Genus Clostridium-Clostridia in medical, veterinary and food microbiology: Diagnosis and typing; 2006.
17. McDonel JL. Clostridium perfringens toxins (type A, B, C, D, E). Pharmacol Ther. 1980; 10(3):617-55.
18. Nilsson J, Ståhl S, Lundeberg J, Uhlén M, Nygren PA. Affinity fusion strategies for detection, purification, and immobilization of recombinant proteins. Protein Expr Purif. 1997; 11(1):1-16.
19. Pilehchian Langroudi R. Isolation, specification, molecular biology assessment and vaccine development of Clostridium in Iran: a review. Int J Enteric Pathog. 2015; 3(4):1-7.
20. Pilehchian Langroudi R, Aghaei PK, Shamsara M, Jabbari A, Habibi G, Goudarzi H, et al. Fusion of Clostridium perfringens type D and B epsilon and beta toxin genes and it’s cloning in E. coli. Arch Razi Inst. 2011; 66: 1-10.
21. Popoff MR. Epsilon toxin: a fascinating pore-forming toxin. FEBS J. 2011; 278(23):4602-15.
22. Popoff MR, Bouvet P. Clostridial toxins. Future Microbiol. 2009; 4(8):1021-64.
23. Rood JI, Adams V, Lacey J, Lyras D, McClane BA, Melville SB, Moore RJ, Popoff MR, Sarker MR, Songer JG, Uzal FA, Van Immerseel F. Expansion of the Clostridium perfringens toxin-based typing scheme. Anaerobe. 2018; 53:5-10.
24. Rood JI, Cole ST. Molecular genetics and pathogenesis of Clostridium perfringens. Microbiol Rev. 1991; 55(4):621-48.
25. Rosano GL, Ceccarelli EA. Recombinant protein expression in Escherichia coli: advances and challenges. Front Microbiol. 2014; 5:172.
26. Sayeed S, Li J, McClane BA. Virulence plasmid diversity in Clostridium perfringens type D isolates. Infect Immun. 2007; 75(5):2391-8.
27. Songer JG. Clostridial enteric diseases of domestic animals. Clin Microbiol Rev. 1996; 9(2):216-34.
28. Steen R, Dahlberg AE, Lade BN, Studier FW, Dunn JJ. T7 RNA polymerase directed expression of the Escherichia coli rrnB operon. EMBO J. 1986; 5(5):1099-103.
29. Uzal FA, Vidal JE, McClane BA, Gurjar AA.  Clostridium Perfringens Toxins Involved in Mammalian Veterinary Diseases. Open Toxinology J. 2010; 2:24-42.
30. Uzal FA, Freedman JC, Shrestha A, Theoret JR, Garcia J, Awad MM, Adams V, Moore RJ, Rood JI, McClane BA. Towards an understanding of the role of Clostridium perfringens toxins in human and animal disease. Future Microbiol. 2014; 9(3):361-77.
31. Zeng J, Deng G, Wang J, Zhou J, Liu X, Xie Q, Wang Y. Potential protective immunogenicity of recombinant Clostridium perfringens α-β2-β1 fusion toxin in mice, sows and cows. Vaccine. 2011; 29(33):5459-66.