Introduction
Shiga toxin-producing Escherichia coli (STEC), one of the most contentious pathogenic strains of E. coli, resides in the gut tract of cattle as the principal reservoir of the bacterium. Pathogeneses of the STEC strains is moderated through the liberation of two toxins, namely Stx1 and/or Stx2, which are encoded by Stx1 and Stx2 genes, respectively. In addition, eae harboring strains may produce an additional virulence factor (i.e., intimin), which impairs the intestinal epithelium through attaching and effacing lesions ( Mahanti et al., 2013 ). Although several serotypes are pertinent to severe illnesses in humans, O157: H7 is the most notorious STEC serotype ( Momtaz et al., 2012b ). The proclivity of the STEC strains to produce infections in cattle and humans is delineated in several studies ( Güler and Gündüz, 2007 , Dormanesh et al., 2014 , Tavakoli and Pourtaghi, 2017 , Zafarane et al., 2017 ). Mastitis is the most economically important disease of dairy cattle. Contamination with feces may lead to the colonization of E. coli, including STEC strains in mammary glands. This is especially highlighted during the early lactation as a consequence of dearth in neutrophil number and function ( Güler and Gündüz, 2007 ). Foodborne infections with STEC through the consumption of contaminated unpasteurized milk and milk products or undercooked meat in humans may trigger a wide spectrum of clinical manifestations fluctuating from mild to severe gastrointestinal symptoms to life-threatening ones, such as haemolytic uraemic (HUC) and haemorrhagic colitis (HC) syndromes ( Mahanti et al., 2013 ). Prophylactic or growth promotion usage of antibiotics in animal husbandry is a common feature in Iran. This may impose a selective pressure to develop resistance genes among not only pathogenic but also commensal bacteria. Potential propagation and dissemination of resistance genes/bacteria from animals to humans is a matter of public health hazard ( Iweriebor et al., 2015 ). Despite the controversies about the prescription of antibiotics in STEC infections in humans, it is substantiated that the application of certain antimicrobial agents in the early stages of the infection may diminish the progress of disease toward HC and HUC ( Dormanesh et al., 2014 ). Although milk plays a potential role and acts as a vehicle for transferring the infection to humans in Kurdistan Province, West of Iran, where unpasteurized milk and dairy products are consumed pervasively, there is a dearth of research on the role of STEC in subclinical bovine mastitis. Therefore, this study aimed to evaluate the frequency of STEC strains focusing on the prevalence of genes (i.e., Stx1, Stx2, and eae), O157: H7 serotype, and antimicrobial resistance profile of the isolates recovered from subclinical bovine mastitis in the mentioned area.
Material and Methods
Sample Collection and E. coli Isolation. A total of 400 subclinical bovine mastitis milk samples were collected equally in four seasons from all over Kurdistan Province, West of Iran, from September 2016 to 2017 and included in this cross-sectional study. The subclinical mastitis was determined using the California Mastitis Test. Approximately, five mL of milk was collected in sterile glass bottles following the disinfection of the udder. The samples were chilled until their delivery to the laboratory within a maximum of five h. The initial cultivation of the samples was performed on Mac Conkey (MC) agar (Quelab, Canada). After the incubation period at 37 °C for 24-36 h, a pink colony from each plate suspicious to E. coli was subcultured on MC agar and Eosin-Methylene blue (EMB) agar (Quelab, Canada). Biochemical identification of the isolates as E. coli was determined based on IMViC, Urea, and TSI reactions. The isolates were cultured in Luria-Bertani broth (Merck, Germany), and after adding 15% glycerol, they were stored at -20 °C until further molecular analysis. Moreover, to confirm the role of E. coli as the sole cause of mastitis, milk samples in which E. coli was isolated were screened for other bacterial agents.
DNA Extraction and Molecular Identification of E. coli. The genomic repertoire of each E. coli isolate was extracted from an overnight culture of the bacterium in Tryptic soy broth(Merck, Germany) using the boiling method ( Guler et al., 2008 ). Molecular conformation of E. coli isolates was performed using species-specific primers ( Riffon et al., 2001 ) (Table 1). The optimized thermal condition included initial denaturation at 94 °C for 4 min followed by 35 cycles of 94 °C for 45 sec, 57 °C for 1 min, 72 °C for 2 min, and a final expansion at 72 °C for 10 min. Polymerase chain reaction (PCR) was prepared in a final volume of 25 µl comprising 12.5 µlready-to use 2X PCR master mix (CinnaGen, Iran), 50 ng of the template DNA, and 0.7 µM of each primer. It should be noted that E. coli O157:H7 (ATCC 43895) was used as a positive control.
Virulence Gene | Sequence (5'→3') | Amplicon size (bp) | Reference |
---|---|---|---|
species-specific | GCTTGACACTGAACATTGAG | 662 | (Riffon et al., 2001) |
GCACTTATCTCTTCCGCATT | |||
eae | GGGATC GAT TACCGT CAT | 837 | (Batchelor et al., 1999) |
TTTATCAGCCTTAAT CTC | |||
Stx1 | CAG TTAATGTCGTGGCGAAGG | 348 | (Cebula et al., 1995) |
CAC CAG ACAATGTAACCGCTG | |||
Stx2 | ATC CTA TTCCCGGGAGTTTAC G | 584 | (Cebula et al., 1995) |
GCGTCATCG TAT ACA CAG GAG C | |||
rfb | AGCCGATGTCGATGCAATT | 339 | (Pan et al., 2002) |
CATGATTCCAAGCCTTGTGC | |||
flic | ACCATCGGTGGAAGCCAG | 461 | (Pan et al., 2002) |
GAAGCATACCCGGCAACAG |
Molecular Detection of stx and eae Virulence Genes. The prevalence of stx genes was evaluated in a duplex PCR reaction using the primer pairs described by Cebula et al. (1995) (Table 1). The PCR master mix included 25 µl ready-to-use 2X PCR master mix (CinnaGen, Iran), 0.8 µM of each Stx1 and Stx2 primers, and 50 ng of the DNA template. E. coli isolates, in which an amplicon for stx genes was produced, were additionally examined for eae gene ( Batchelor et al., 1999 ). The reaction mixture of eae amplification was the same as the species-specific PCR reaction. The PCR condition for both reactions was based on the method proposed by Osek (2003) including initial denaturation at 94 °C for 4 min followed by 30 cycles at 94, 53, and 72 °C for 1 min, and a final expansion at 72 °C for 5 min ( Osek, 2003 ). It is worth mentioning that E. coli ATCC 43895 strain was used as a positive control.
Molecular Detection of rfbO157 and flicH7 Genes. To categorize the stx/eae harboring isolates to O157 or non-O157 serotypes and screen flicH7 gene, a duplex PCR assay was applied based on the method presented by Pan et al. (2002) (Table 1). The PCR master mix contained the same volumes as to the duplex stx PCR reaction. The positive control was the same as the preceding assays. The PCR thermal condition was 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 sec, annealing at 63 °C for 30 sec, and elongation at 72 °C for 80 sec ( Pan et al., 2002 ).
All PCR products were electrophoresed on 1.2% agarose gel stained with DNA SYBR safe (Invitrogen, USA) and visualized under ultraviolet light.
Antimicrobial Susceptibility Testing. Antimicrobial resistance patterns of the isolates were determined using the standard agar disk diffusion method under the Clinical and Laboratory Standards Institute recommendations ( CLSI, 2013 ). The quality control organism used in the antibiogram test was E. coli ATCC 25922. The antibiotics that were tested included chloramphenicol (CHL: 30 µg), gentamycin (GEN: 5 µg), nitrofurantoin (NIT: 300 µg), ciprofloxacin (CIP: 5 µg), streptomycin (STR: 10 µg), lincomycin (LIN: 15 µg), tetracycline (TET: 30 µg), trimethoprim-sulfadiazine (SXT: 5+300 µg), amoxicillin-clavulanic acid (AUG: 20+10 µg), nalidixic acid (NAL: 30 µg), ampicillin (AMP: 10 µg), and ceftriaxone (CTR: 30 µg). The antibiotic discs were purchased from Patan Teb Co., Iran.
Statistical Analysis. The correlation between the frequency of E. coli and STEC isolates with season was analyzed in SPSS software (version 21.0) using the Chi-square test. A p-value less than 0.05 was considered statistically significant.
Results
A total of 173 (43.25%) E. coli strains were isolated and identified from the samples based on phenotypic and genotypic methods (Figure 1). Moreover, molecular screening of Stx1, Stx2, and eae genes revealed that 39 isolates (22.54%) harbored at least one of the mentioned virulence genes. Duplex PCR for Stx1 and Stx2 genes manifested that 31 (79.48%) and eight (20.51%) isolates possessed Stx2 and Stx1+Stx2 genes, respectively. The Stx1 gene was not detected in any isolates alone. The gene eae was detected in eight isolates (20.51%), of which six and two were in Stx2 and Stx1+Stx2 harboring isolates, respectively (Figure 2).
Figure 1. Agarose gel electrophoresis of PCR products with E. coli species-specific primers (662 bp). M: 100 bp DNA Ladder (CinnaGen, Iran), PC: positive control (E. coli O157:H7 ATCC 43895). NC: negative control. Lanes 1-9: field samples.
Figure 2. Agarose gel electrophoresis representing diverse genetic profiles among STEC isolated from subclinical bovine mastitis milk samples. M: 100 bp DNA Ladder (CinnaGen, Iran), PC: positive control (E. coli O157:H7 ATCC 43895: the amplicon sizes of 837 bp, 584 bp, and 348 bp allocate for eae, stx2, and stx1 genes, respectively). Lane 1: profile stx1+stx2 (six isolates); Lane 2: profile stx1+stx2+eae (two isolates); Lane 3: profile stx2 (25 isolates); Lane 4: profile stx2+eae (six isolates)..
The virulence gene profile of the STEC strains was in four diverse combinations, of which Stx2 genotype had the highest frequency (64.10%) (Table 2). Similarly, five (12.82%) out of 39 STEC isolates possessed the rfbO157 gene, among which three of them carried the flicH7 gene (Figure 3). Furthermore, the other 34 (81.17%) isolates belonged to non-O157 serotypes. The genotypes of O157 and non-O157 STEC isolates are indicated in Table 2. In addition, no other bacteria were isolated from the milk samples contaminated with E. coli. Table 3 represents the frequency of E. coli and STEC isolates regarding the season. All of the E. coli isolates were resistant to at least one antimicrobial agent; however, no isolate was resistant to all of them. Multidrug resistance, resistance to at least three classes of antibiotics, was detected in 31 (79.48%) isolates. Moreover, no common resistance pattern was represented among the isolates. All of the non-O157 STEC serotypes were resistant to STR, TET, and AMP. Resistance to CTR (85.29%), LIN (85.29%), and CHL (79.41%) was also observed. NAL (23.52%), SXT (32.35%), NIT (32.35%), CIR (44.11%) and GEN (50%) were the most effective antibiotics against the non-O157 strains, respectively. All five O157 STEC isolates were resistant to AMP and STR but susceptible to TET (60%). Resistance to NIT (20%), NAL (20%), CTR (20%), SXT (40%), AUG (40%), and GEN (40%) was observed in less frequency. In the same vein, no significant relationship was revealed between the frequency of E. coli with the season (Table 3). In addition, there was no statistical association between the frequency of STEC and season (Table 3).
Genetic profile | No. of isolates | Percent of isolates in each group | Percent of isolates in total | |||
---|---|---|---|---|---|---|
O157 serotype | non-O157 serotype | O157 serotype | non-O157 serotype | O157 serotype | non-O157 serotype | |
Stx2 | - | 25 | 0% | 100% | 0% | 64.10% |
Stx2+eae | 2 | 4 | 33.33% | 66.66% | 5.12% | 10.25% |
Stx1+Stx2 | 1* | 5 | 16.66% | 83.33% | 2.56% | 12.82% |
Stx1+Stx2+eae | 2* | - | 100% | 0% | 5.12% | 0% |
Figure 3. Agarose gel electrophoresis of PCR products with rfbO157 (339 bp) and flicH7 (461 bp) primers. M: 100 bp DNA Ladder (CinnaGen, Iran), PC: positive control (E. coli O157:H7 ATCC 43895). NC: negative control. Lanes 1-3: O157:H7 field samples (3 isolates). Lanes 4-5: O157: H- field samples (2 isolates).
Season | No. of samples | No. of E. coli isolates | No. of STEC isolates | ||
---|---|---|---|---|---|
non-O157 serotype | O157 serotype | ||||
H7 | Non-H7 | ||||
Autumn | 100 | 52 | 12 | 2 | |
Winter | 100 | 66 | 14 | 1 | 1 |
Spring | 100 | 37 | 5 | ||
Summer | 100 | 18 | 3 | ||
Total | 400 | 173 | 34 | 3 | 2 |
P-value | - | 0.059 | 0.051 |
Discussion
The insidious economic costs imposed on dairy husbandry by mastitis are intensive worldwide. This is more emphasized in the cases of subclinical mastitis because of the lack of obvious symptoms ( Momtaz et al., 2012a ). Escherichia coli is incriminated as a cause of bovine clinical and subclinical mastitis. The STEC strains are not only isolated frequently from mastitis cases but also severe human illnesses ( Momtaz et al., 2012b ; Dormanesh et al., 2014 ; Tavakoli and Pourtaghi, 2017 ; Zafarane et al., 2017 ). Consumption of unpasteurized milk and dairy products are very common and popular in Kurdistan Province, West of Iran. This underlines the potential role of milk as a vehicle for transferring the bacterium to the human food chain. In addition to cattle feces, other various sources of STEC contamination include the contaminated environment, water, equipment, infected workers or unhygienic handling, and marketing of milk constitute. A beneficial advantage of the direct sampling from the udder of lactating cows is to prevent extraneous contamination of the samples. This ensures the direct origin of presented bacteria from mammary glands. Accordingly, the probable sources of bacterial contamination in milk are identified promptly ( Momtaz et al., 2012b ). The overall prevalence of STEC isolated in the present study was 22.54%. In the other studies undertaken in different districts of Iran, the distribution values of STEC in bovine mastitis milk samples were 64.38%, 21.6% ( Tavakoli and Pourtaghi, 2017 ), and 2.5% ( Zafarane et al., 2017 ). In line with the results of the present study, the prevalence of STEC investigated in mastitis milk samples in Brazil was 22% ( Lira et al., 2004 ). Lower and higher frequencies of STEC in mastitis milk samples were reported from Brazil (9.5%) ( Rangel and Marin, 2009 ) and Ogun State, Nigeria (32%) ( Ivbade et al., 2014 ), respectively. On the other hand, no STEC isolate was detected from mastitis milk samples in Konya, Turkey ( Güler and Gündüz, 2007 ). The fluctuation in the frequency of STEC in bovine mastitis milk samples in different parts of Iran and the world may be related to geographical and seasonal variables, sampling period, hygienic and management status, the herds and sample sizes, and the breed of cows ( Momtaz et al., 2012a ; Zafarane et al., 2017 ). Additionally, in some internal studies, the rates of raw milk contamination with STEC were determined at 0.76% in Mashhad, Northeast of Iran ( Brenjchi et al., 2011 ), 17.47% in Kermanshah, West of Iran ( Mohammadi et al., 2013 ), 35.28% in Shahrekord, Center of Iran ( Momtaz et al., 2012a ), and 33.33% in Tehran, Capital of Iran ( Mashak, 2018 ). Generally, based on the preceding reports, unpasteurized milk may be a potential vector for STEC in Iran. Our results represented a higher prevalence of Stx2, compared to Stx1 which coincides with the results obtained from STEC strains isolated from bovine mastitis milk samples in Tehran ( Zafarane et al., 2017 ). In addition, 100% of the E. coli strains isolated from clinical and subclinical buffalo mastitis milk samples in Egypt were harboring Stx2 ( Lamey et al., 2013 ). However, this is in contrast with the higher distribution of Stx1 reported by Momtaz et al. (2012b) , Tavakoli and Pourtaghi (2017) , and Mashak (2018) from Iran ( Momtaz et al., 2012b ; Tavakoli and Pourtaghi, 2017 ; Mashak, 2018 ). It is clarified that Stx2 is more associated with human HUS and HC syndromes. The simultaneous existence of Stx1 and Stx2 genes was detected in 20.51% of the STEC isolates in the present study, compared to 13.88%, 22.2%, and 7.7% reported from Shahrekord, Tehran, and Alborz Province, Iran, respectively ( Momtaz et al., 2012b ; Tavakoli and Pourtaghi, 2017 ; Zafarane et al., 2017 ). Moreover, our results were in contrast with those reported Stx1 as the predominant stx gene harbored by STEC strains isolated from cattle ( Kobori et al., 2004 ). Differences in sampling time are verified as a plausible explanation for the variation in the frequencies of stx genes among different studies, and it is proved that the distribution of stx genes has fluctuated at different times. The proportion of eae gene among the STEC isolates in the present study was 20.51%. This value is lower than the frequency of eae detected from STEC strains isolated from bovine mastitis milk samples in other internal studies ( Tavakoli and Pourtaghi, 2017 ; Zafarane et al., 2017 ). Although the mode of action of eae gene in bovine mastitis is unknown, intimin is assumed as a complementary virulence factor for human illnesses with STEC through the induction of attaching and effacing lesions in gut mucosa ( Mahanti et al., 2013 ). The distribution of O157 serotype was 12.82% (5 isolates), among which 60% (3 isolates) of them were O157:H7. Higher (15.06%) and lower (11.11%) frequencies of O157 serotype were reported from STEC isolated from mastitis milk samples in Shahrekord and Tehran, Iran, respectively ( Momtaz et al., 2012b ; Zafarane et al., 2017 ). To the best of our knowledge, no data is available about the frequency of O157:H7 serotype involved in bovine mastitis in internal studies. ( Brenjchi et al. (2011) ) reported a 6.15% frequency of STEC in raw bulk tank milk samples delivered to Pegah Pasteurization Factory of Mashhad, among which only one isolate (12.5%) was O157:H7 ( Brenjchi et al., 2011 ). The prevalence of STECO 157:H7 serotype in raw milk in the Ogun State of Nigeria was 2% ( Ivbade et al., 2014 ), whereas no O157 serotype was detected from raw milk in Kermanshah, Iran ( Mohammadi et al., 2013 ). Although the origin of STECO157:H7 isolates was the infected udder in the present study, the contaminated skin, feces, and environment could be the sources of infection in raw milk. Therefore, in addition to the control and treatment of mastitis, the promotion of hygienic conditions and the application of sanitary measures in farms is vital to reduce the rate of raw milk contamination with STEC strains ( Zafarane et al., 2017 ; Mashak, 2018 ). Unfortunately, indiscriminative use of antibiotics is a common feature, and exertion of rigid control over the misuse of antimicrobial drugs, particularly in animal husbandry, is not acceptable in Iran. Therefore, screening of new emerging antimicrobial resistance against pathogenic bacteria with a focus on the zoonotic pathogens is of great concern ( Momtaz et al., 2012b ). A total of 100% of the examined isolates in the present study depicted antimicrobial resistance to one or several examined antimicrobial agents. The highest resistance levels were exhibited to streptomycin, ampicillin, and tetracycline, which was in agreement with the results obtained from the previous studies. In contrast, a discrete level of resistance to the preceding antibiotics has been reported by Lanz et al. (2003) in Switzerland ( Lanz et al., 2003 ). In other investigations undertaken in Iran, resistance to penicillin, tetracycline, lincomycin, ampicillin, tetracycline, trimethoprim-sulphamethoxazole, and chloramphenicol ( Zafarane et al., 2017 ), as well as penicillin, tylosin, oxytetracycline, erythromycin, ampicillin, streptomycin, and neomycin ( Tavakoli and Pourtaghi, 2017 ) was the highest among STEC strains isolated from bovine with mastitis. Briefly, based on the available data, prescription of tetracycline and beta-lactamases may not be effective against E. coli-originated bovine mastitis in Iran ( Zafarane et al., 2017 ). A high proportion of multidrug resistance (79.48%) was identified in the present study. The rates of multidrug resistance among the STEC isolated from bovine mastitis in Tehran and Alborz Provinces, Iran, were 100% and 77.77%, respectively ( Tavakoli and Pourtaghi, 2017 ; Zafarane et al., 2017 ), whereas no STEC isolates with multidrug resistance were reported from raw milk samples in Kermanshah, Iran ( Mohammadi et al., 2013 ). In addition, multidrug resistance has been reported in other studies ( Rangel and Marin, 2009 ; Mora et al., 2005 ). The existence of high rates of multidrug resistance among STEC strains represents a negative prognosis for the treatment of life-threatening infections caused by STEC in human. Moreover, the propagation of resistance genes from E. coli strains to other pathogenic or commensal strains is the other aspect of the hazard in the public and dairy sector ( Dormanesh et al., 2014 ).
It can be concluded that the wide distribution of multidrug resistance STEC, as well as harboring Stx1, Stx2, and eae genes in mastitis bovine milk in western Iran, makes milk a potential vector for zoonotic STEC transmission from cattle to humans. This should be taken into account to apply adequate control and prevention procedures and establish long-term strategies to guarantee the safety of food from dairy cattle. Furthermore, continued surveillance of E. coli isolates should be conducted on dairy cows to detect subclinical mastitis. Future studies should be aimed to investigate the distribution of this isolate in other food products in the region.
Ethics
We hereby declare all ethical standards have been respected in preparation of the submitted article.
Authors’ Contribution
Study concept and design: Ahmadi, E.
Acquisition of data: Ahmadi, E.; Amiri, A.
Analysis and interpretation of data: Ahmadi, E.
Drafting of the manuscript: Ahmadi, E.
Critical revision of the manuscript for important intellectual content: Mardani, K.
Statistical analysis: Mardani, K.
Administrative, technical, and material support: Ahmadi, E.
Acknowledgement
The authors would like to express their gratitude to Sanandaj Branch, Islamic Azad University, Sanandaj, Iran.
Conflict of Interest: The authors declare that they have no conflict of interest.
References
- Batchelor M, Knutton S, Caprioli A, Huter V, Zanial M, Dougan G. Development of a universal intimin antiserum and PCR primers. J Clin Microbiol. 1999; 37(12):3822-7.
- Brenjchi M, Jamshidi A, Farzaneh N, Bassami MR. Identification of shiga toxin producing Escherichia coli O157:H7 in raw cow milk samples from dairy farms in Mashhad using multiplex PCR assay. Iran J Vet Res. 2011; 12: 145-149.
- Cebula TA, Payne WL, Feng P. Simultaneous identification of strains of Escherichia coli serotype O157:H7 and their Shiga-like toxin type by mismatch amplification mutation assay-multiplex PCR. J Clin Microbiol. 1995; 33(1):248-50.
- CLS. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animal; approved standard, Clinical and Laboratory Standards Institute, Wayne, PA; 2013.
- Dormanesh B, Safarpoor Dehkordi F, Hosseini S, Momtaz H, Mirnejad R, Hoseini MJ. Virulence factors and o-serogroups profiles of uropathogenic Escherichia coli isolated from Iranian pediatric patients. Iran Red Crescent Med J. 2014; 16(2):e14627.
- Güler L, Gündüz K. Virulence properties of Escherichia coli isolated from clinical bovine mastitis. Turk J Vet Anim Sci. 2007; 31: 361-365.
- Guler L, Gunduz K, Ok U. Virulence factors and antimicrobial susceptibility of Escherichia coli isolated from calves in Turkey. Zoonoses Public Health. 2008; 55: 249-257.
- Ivbade A, Ojo OE, Dipeolu MA. Shiga toxin-producing Escherichia coli O157:H7 in milk and milk products in Ogun State, Nigeria. Vet Ital. 2014; 50(3):185-91.
- Iweriebor BC, Iwu CJ, Obi LC, Nwodo UU, Okoh AI. Multiple antibiotic resistances among Shiga toxin producing Escherichia coli O157 in feces of dairy cattle farms in Eastern Cape of South Africa. BMC Microbiol. 2015; 15:213.
- Kobori D, Rigobelo EC, Macedo C, Marin JM, Avila FA. Virulence properties of Shiga toxin-producing Escherichia coli isolated from cases of bovine Mastitis in Brazil. Rev Elevage MedVet Pays Trop. 2004; 57: 15-20.
- Lamey AE, Ammar AM, Zaki ER, Khairy N, Moshref BS, Refai MK. Virulence factors of Escherichia coli isolated from recurrent cases of clinical and subclinical mastitis in buffaloes. Intl J. 2013; 4(1):86-94.
- Lanz R, Kuhnert P, Boerlin P. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet Microbiol. 2003; 91: 73-84.
- Lira WM, Macedo C, Marin JM. The incidence of Shiga toxin-producing Escherichia coli in cattle with mastitis in Brazil. J Appl Microbiol. 2004; 97(4):861-6.
- Mahanti A, Samanta I, Bandopaddhay S, Joardar SN, Dutta TK, Batabyal S, Sar TK, Isore DP. Isolation, molecular characterization and antibiotic resistance of Shiga Toxin-Producing Escherichia coli (STEC) from buffalo in India. Lett Appl Microbiol. 2013; 56(4):291-8.
- Mashak Z. Virulence genes and phenotypic evaluation of the antibiotic resistance of vero toxin producing escherichia coli recovered from milk, meat, and vegetables. Jundishapur J Microbiol. 2018; 11: e62288.
- Mohammadi P, Abiri R, Rezaei M, Salmanzadeh-Ahrabi S. Isolation of Shiga toxin-producing Escherichia coli from raw milk in Kermanshah, Iran. Iran J Microbiol. 2013; 5(3):233-8.
- Momtaz H, Farzan R, Rahimi E, Safarpoor Dehkordi F, Souod N. Molecular characterization of Shiga toxin-producing Escherichia coli isolated from ruminant and donkey raw milk samples and traditional dairy products in Iran. Sci World J. 2012; 2012:231342.
- Momtaz H, Safarpoor Dehkordi F, Taktaz T, Rezvani A, Yarali S. Shiga toxin-producing Escherichia coli isolated from bovine mastitic milk: serogroups, virulence factors, and antibiotic resistance properties. Sci World J. 2012; 2012: 618709.
- Mora A, Blanco JE, Blanco M, Alonso MP, Dhabi G, Echeita A, González EA, Bernárdez MI, Blanco J. Antimicrobial resistance of Shiga toxin (verotoxin)-producing Escherichia coli O157:H7 and non-O157 strains isolated from humans, cattle, sheep and food in Spain. Res Microbiol. 2005; 156(7):793-806.
- Osek J. Development of a multiplex PCR approach for the identification of Shiga toxin-producing Escherichia coli strains and their major virulence factor genes. J Appl Microbiol. 2003; 95(6):1217-25.
- Pan TM, Chen LM, Su YC. Identification of Escherichia coli O157:H7 by multiplex PCR with primers specific to the hlyA, eaeA, stx1, stx2, fliC and rfb genes. J Formos Med Assoc. 2002; 101(9):661-4.
- Rangel P, Marin JM. Analysis of Escherichia coli isolated from bovine mastitic milk. Pesqui Vet Bras. 2009; 29: 363-368.
- Riffon R, Sayasith K, Khalil H, Dubreuil P, Drolet M, Lagace J. Development of a rapid and sensitive test for identification of major pathogens in bovine mastitis by PCR. J Clin Microbiol. 2001; 39: 2584-2589.
- Tavakoli M, Pourtaghi H. Molecular detection of virulence genes and multi-drug resistance patterns in Escherichia coli (STEC) in clinical bovine mastitis: Alborz province, Iran. Iran J Vet Res. 2017; 18(3):208-211.
- Zafarane S, Houri H, Kazemian H, Heidari H, Amiri P, Tabarraei B. Characterization of virulence genes, serogroups and antimicrobial susceptibility of Shiga toxin producing Escherichia coli isolated from bovine mastitic milk in Tehran, Iran. Tropl Biomed. 2017; 34(2):295-304.